ID: 971048547

View in Genome Browser
Species Human (GRCh38)
Location 4:22832748-22832770
Sequence CTGGTTCTATGTGGGCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971048547_971048556 24 Left 971048547 4:22832748-22832770 CCACTATGCCCACATAGAACCAG No data
Right 971048556 4:22832795-22832817 CACCCTCAGGCTCATCTTCAGGG No data
971048547_971048554 11 Left 971048547 4:22832748-22832770 CCACTATGCCCACATAGAACCAG No data
Right 971048554 4:22832782-22832804 CCTACATGATCAGCACCCTCAGG No data
971048547_971048557 25 Left 971048547 4:22832748-22832770 CCACTATGCCCACATAGAACCAG No data
Right 971048557 4:22832796-22832818 ACCCTCAGGCTCATCTTCAGGGG No data
971048547_971048555 23 Left 971048547 4:22832748-22832770 CCACTATGCCCACATAGAACCAG No data
Right 971048555 4:22832794-22832816 GCACCCTCAGGCTCATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971048547 Original CRISPR CTGGTTCTATGTGGGCATAG TGG (reversed) Intergenic
No off target data available for this crispr