ID: 971050218

View in Genome Browser
Species Human (GRCh38)
Location 4:22853671-22853693
Sequence TCACATAAACTTAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971050218_971050226 26 Left 971050218 4:22853671-22853693 CCCTCTACCTTAAGTTTATGTGA No data
Right 971050226 4:22853720-22853742 GAAGACAGCAGAAAGTTGGTTGG No data
971050218_971050222 -7 Left 971050218 4:22853671-22853693 CCCTCTACCTTAAGTTTATGTGA No data
Right 971050222 4:22853687-22853709 TATGTGAGTCCTTATGGTTTAGG No data
971050218_971050224 22 Left 971050218 4:22853671-22853693 CCCTCTACCTTAAGTTTATGTGA No data
Right 971050224 4:22853716-22853738 TCCTGAAGACAGCAGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971050218 Original CRISPR TCACATAAACTTAAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr