ID: 971051254

View in Genome Browser
Species Human (GRCh38)
Location 4:22865207-22865229
Sequence ACATGGCCAAAGATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971051254_971051258 8 Left 971051254 4:22865207-22865229 CCTGACTCCATCTTTGGCCATGT No data
Right 971051258 4:22865238-22865260 TGGCATCTGTCTAGTTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971051254 Original CRISPR ACATGGCCAAAGATGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr