ID: 971054051

View in Genome Browser
Species Human (GRCh38)
Location 4:22892827-22892849
Sequence GTAGAAGAACAGAAGCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971054051_971054057 2 Left 971054051 4:22892827-22892849 CCCATAGGCTTCTGTTCTTCTAC No data
Right 971054057 4:22892852-22892874 CAAGTTACTTACTTTTCTGTGGG No data
971054051_971054056 1 Left 971054051 4:22892827-22892849 CCCATAGGCTTCTGTTCTTCTAC No data
Right 971054056 4:22892851-22892873 CCAAGTTACTTACTTTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971054051 Original CRISPR GTAGAAGAACAGAAGCCTAT GGG (reversed) Intergenic
No off target data available for this crispr