ID: 971060280

View in Genome Browser
Species Human (GRCh38)
Location 4:22960474-22960496
Sequence CTCTTTCTTGATCTTGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971060278_971060280 9 Left 971060278 4:22960442-22960464 CCCTATTTATTTCTTTCTCTTCT No data
Right 971060280 4:22960474-22960496 CTCTTTCTTGATCTTGTCTCAGG No data
971060279_971060280 8 Left 971060279 4:22960443-22960465 CCTATTTATTTCTTTCTCTTCTC No data
Right 971060280 4:22960474-22960496 CTCTTTCTTGATCTTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971060280 Original CRISPR CTCTTTCTTGATCTTGTCTC AGG Intergenic
No off target data available for this crispr