ID: 971060971

View in Genome Browser
Species Human (GRCh38)
Location 4:22969182-22969204
Sequence TGAACATGCATTACAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971060971_971060974 12 Left 971060971 4:22969182-22969204 CCACCCACTGTAATGCATGTTCA No data
Right 971060974 4:22969217-22969239 AAAGATATACTTCTGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971060971 Original CRISPR TGAACATGCATTACAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr