ID: 971062372

View in Genome Browser
Species Human (GRCh38)
Location 4:22986852-22986874
Sequence GTGCACCTGACTCCAAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971062372_971062375 30 Left 971062372 4:22986852-22986874 CCAATCTTTGGAGTCAGGTGCAC No data
Right 971062375 4:22986905-22986927 TGTGTATGATTTTTGAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971062372 Original CRISPR GTGCACCTGACTCCAAAGAT TGG (reversed) Intergenic
No off target data available for this crispr