ID: 971063784

View in Genome Browser
Species Human (GRCh38)
Location 4:23003879-23003901
Sequence GTATCTGGTTAGTTTAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971063784_971063787 -2 Left 971063784 4:23003879-23003901 CCCTGATTAAACTAACCAGATAC No data
Right 971063787 4:23003900-23003922 ACATATGCTGTACCAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971063784 Original CRISPR GTATCTGGTTAGTTTAATCA GGG (reversed) Intergenic
No off target data available for this crispr