ID: 971068293

View in Genome Browser
Species Human (GRCh38)
Location 4:23060121-23060143
Sequence TAGGGGCCTCAGTGTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971068293_971068303 14 Left 971068293 4:23060121-23060143 CCAAGATGACACTGAGGCCCCTA No data
Right 971068303 4:23060158-23060180 GGCAGTATCACAGCAAAAGGTGG No data
971068293_971068302 11 Left 971068293 4:23060121-23060143 CCAAGATGACACTGAGGCCCCTA No data
Right 971068302 4:23060155-23060177 AAAGGCAGTATCACAGCAAAAGG No data
971068293_971068294 -7 Left 971068293 4:23060121-23060143 CCAAGATGACACTGAGGCCCCTA No data
Right 971068294 4:23060137-23060159 GCCCCTACCCAGCATCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971068293 Original CRISPR TAGGGGCCTCAGTGTCATCT TGG (reversed) Intergenic
No off target data available for this crispr