ID: 971075127

View in Genome Browser
Species Human (GRCh38)
Location 4:23139296-23139318
Sequence TATGTCAAAGATTTGTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971075127_971075128 -10 Left 971075127 4:23139296-23139318 CCACATGACAAATCTTTGACATA No data
Right 971075128 4:23139309-23139331 CTTTGACATAGTTCAATGCTTGG No data
971075127_971075129 -1 Left 971075127 4:23139296-23139318 CCACATGACAAATCTTTGACATA No data
Right 971075129 4:23139318-23139340 AGTTCAATGCTTGGCACTCCAGG No data
971075127_971075130 14 Left 971075127 4:23139296-23139318 CCACATGACAAATCTTTGACATA No data
Right 971075130 4:23139333-23139355 ACTCCAGGTGTGCCTCGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971075127 Original CRISPR TATGTCAAAGATTTGTCATG TGG (reversed) Intergenic
No off target data available for this crispr