ID: 971075130

View in Genome Browser
Species Human (GRCh38)
Location 4:23139333-23139355
Sequence ACTCCAGGTGTGCCTCGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971075127_971075130 14 Left 971075127 4:23139296-23139318 CCACATGACAAATCTTTGACATA No data
Right 971075130 4:23139333-23139355 ACTCCAGGTGTGCCTCGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971075130 Original CRISPR ACTCCAGGTGTGCCTCGTTG AGG Intergenic
No off target data available for this crispr