ID: 971076068

View in Genome Browser
Species Human (GRCh38)
Location 4:23151465-23151487
Sequence TTATAGGCACAGAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971076068_971076081 23 Left 971076068 4:23151465-23151487 CCCACCTCATTCTGTGCCTATAA No data
Right 971076081 4:23151511-23151533 GGGGAGAAGCAGCTGGACACTGG No data
971076068_971076075 3 Left 971076068 4:23151465-23151487 CCCACCTCATTCTGTGCCTATAA No data
Right 971076075 4:23151491-23151513 CCCCAGACTCAGCTGGCCTAGGG No data
971076068_971076083 25 Left 971076068 4:23151465-23151487 CCCACCTCATTCTGTGCCTATAA No data
Right 971076083 4:23151513-23151535 GGAGAAGCAGCTGGACACTGGGG No data
971076068_971076082 24 Left 971076068 4:23151465-23151487 CCCACCTCATTCTGTGCCTATAA No data
Right 971076082 4:23151512-23151534 GGGAGAAGCAGCTGGACACTGGG No data
971076068_971076073 2 Left 971076068 4:23151465-23151487 CCCACCTCATTCTGTGCCTATAA No data
Right 971076073 4:23151490-23151512 ACCCCAGACTCAGCTGGCCTAGG No data
971076068_971076072 -4 Left 971076068 4:23151465-23151487 CCCACCTCATTCTGTGCCTATAA No data
Right 971076072 4:23151484-23151506 ATAAAGACCCCAGACTCAGCTGG 0: 20
1: 58
2: 77
3: 97
4: 313
971076068_971076079 16 Left 971076068 4:23151465-23151487 CCCACCTCATTCTGTGCCTATAA No data
Right 971076079 4:23151504-23151526 TGGCCTAGGGGAGAAGCAGCTGG No data
971076068_971076077 4 Left 971076068 4:23151465-23151487 CCCACCTCATTCTGTGCCTATAA No data
Right 971076077 4:23151492-23151514 CCCAGACTCAGCTGGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971076068 Original CRISPR TTATAGGCACAGAATGAGGT GGG (reversed) Intergenic
No off target data available for this crispr