ID: 971076770

View in Genome Browser
Species Human (GRCh38)
Location 4:23158374-23158396
Sequence CAGCGTACAGCAGGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971076770_971076785 24 Left 971076770 4:23158374-23158396 CCATCCACCCCTGCTGTACGCTG No data
Right 971076785 4:23158421-23158443 CCACCCTTCCGGATCTGGCAGGG No data
971076770_971076783 23 Left 971076770 4:23158374-23158396 CCATCCACCCCTGCTGTACGCTG No data
Right 971076783 4:23158420-23158442 TCCACCCTTCCGGATCTGGCAGG No data
971076770_971076782 19 Left 971076770 4:23158374-23158396 CCATCCACCCCTGCTGTACGCTG No data
Right 971076782 4:23158416-23158438 TACTTCCACCCTTCCGGATCTGG No data
971076770_971076780 13 Left 971076770 4:23158374-23158396 CCATCCACCCCTGCTGTACGCTG No data
Right 971076780 4:23158410-23158432 GCCATTTACTTCCACCCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971076770 Original CRISPR CAGCGTACAGCAGGGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr