ID: 971077130

View in Genome Browser
Species Human (GRCh38)
Location 4:23163070-23163092
Sequence TTATATAAGGGAAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971077130_971077136 -1 Left 971077130 4:23163070-23163092 CCTTCCACCCTTCCCTTATATAA No data
Right 971077136 4:23163092-23163114 AAAGCTAATCCGTTGAAAAGTGG No data
971077130_971077139 10 Left 971077130 4:23163070-23163092 CCTTCCACCCTTCCCTTATATAA No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data
971077130_971077137 5 Left 971077130 4:23163070-23163092 CCTTCCACCCTTCCCTTATATAA No data
Right 971077137 4:23163098-23163120 AATCCGTTGAAAAGTGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971077130 Original CRISPR TTATATAAGGGAAGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr