ID: 971077131

View in Genome Browser
Species Human (GRCh38)
Location 4:23163074-23163096
Sequence GCTTTTATATAAGGGAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971077131_971077139 6 Left 971077131 4:23163074-23163096 CCACCCTTCCCTTATATAAAAGC No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data
971077131_971077137 1 Left 971077131 4:23163074-23163096 CCACCCTTCCCTTATATAAAAGC No data
Right 971077137 4:23163098-23163120 AATCCGTTGAAAAGTGGATTTGG No data
971077131_971077136 -5 Left 971077131 4:23163074-23163096 CCACCCTTCCCTTATATAAAAGC No data
Right 971077136 4:23163092-23163114 AAAGCTAATCCGTTGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971077131 Original CRISPR GCTTTTATATAAGGGAAGGG TGG (reversed) Intergenic
No off target data available for this crispr