ID: 971077133

View in Genome Browser
Species Human (GRCh38)
Location 4:23163078-23163100
Sequence ATTAGCTTTTATATAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971077133_971077137 -3 Left 971077133 4:23163078-23163100 CCTTCCCTTATATAAAAGCTAAT No data
Right 971077137 4:23163098-23163120 AATCCGTTGAAAAGTGGATTTGG No data
971077133_971077136 -9 Left 971077133 4:23163078-23163100 CCTTCCCTTATATAAAAGCTAAT No data
Right 971077136 4:23163092-23163114 AAAGCTAATCCGTTGAAAAGTGG No data
971077133_971077139 2 Left 971077133 4:23163078-23163100 CCTTCCCTTATATAAAAGCTAAT No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971077133 Original CRISPR ATTAGCTTTTATATAAGGGA AGG (reversed) Intergenic
No off target data available for this crispr