ID: 971077135

View in Genome Browser
Species Human (GRCh38)
Location 4:23163083-23163105
Sequence AACGGATTAGCTTTTATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971077135_971077137 -8 Left 971077135 4:23163083-23163105 CCTTATATAAAAGCTAATCCGTT No data
Right 971077137 4:23163098-23163120 AATCCGTTGAAAAGTGGATTTGG No data
971077135_971077140 28 Left 971077135 4:23163083-23163105 CCTTATATAAAAGCTAATCCGTT No data
Right 971077140 4:23163134-23163156 TGAACTTTGAATAGAATCTTTGG No data
971077135_971077139 -3 Left 971077135 4:23163083-23163105 CCTTATATAAAAGCTAATCCGTT No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971077135 Original CRISPR AACGGATTAGCTTTTATATA AGG (reversed) Intergenic
No off target data available for this crispr