ID: 971077136

View in Genome Browser
Species Human (GRCh38)
Location 4:23163092-23163114
Sequence AAAGCTAATCCGTTGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971077132_971077136 -8 Left 971077132 4:23163077-23163099 CCCTTCCCTTATATAAAAGCTAA No data
Right 971077136 4:23163092-23163114 AAAGCTAATCCGTTGAAAAGTGG No data
971077133_971077136 -9 Left 971077133 4:23163078-23163100 CCTTCCCTTATATAAAAGCTAAT No data
Right 971077136 4:23163092-23163114 AAAGCTAATCCGTTGAAAAGTGG No data
971077130_971077136 -1 Left 971077130 4:23163070-23163092 CCTTCCACCCTTCCCTTATATAA No data
Right 971077136 4:23163092-23163114 AAAGCTAATCCGTTGAAAAGTGG No data
971077131_971077136 -5 Left 971077131 4:23163074-23163096 CCACCCTTCCCTTATATAAAAGC No data
Right 971077136 4:23163092-23163114 AAAGCTAATCCGTTGAAAAGTGG No data
971077129_971077136 26 Left 971077129 4:23163043-23163065 CCTGTTTTATTTGGCATAATCTG No data
Right 971077136 4:23163092-23163114 AAAGCTAATCCGTTGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971077136 Original CRISPR AAAGCTAATCCGTTGAAAAG TGG Intergenic
No off target data available for this crispr