ID: 971077138

View in Genome Browser
Species Human (GRCh38)
Location 4:23163101-23163123
Sequence AATCCAAATCCACTTTTCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971077138_971077141 15 Left 971077138 4:23163101-23163123 CCGTTGAAAAGTGGATTTGGATT No data
Right 971077141 4:23163139-23163161 TTTGAATAGAATCTTTGGAGTGG No data
971077138_971077143 21 Left 971077138 4:23163101-23163123 CCGTTGAAAAGTGGATTTGGATT No data
Right 971077143 4:23163145-23163167 TAGAATCTTTGGAGTGGAATGGG No data
971077138_971077144 22 Left 971077138 4:23163101-23163123 CCGTTGAAAAGTGGATTTGGATT No data
Right 971077144 4:23163146-23163168 AGAATCTTTGGAGTGGAATGGGG No data
971077138_971077140 10 Left 971077138 4:23163101-23163123 CCGTTGAAAAGTGGATTTGGATT No data
Right 971077140 4:23163134-23163156 TGAACTTTGAATAGAATCTTTGG No data
971077138_971077142 20 Left 971077138 4:23163101-23163123 CCGTTGAAAAGTGGATTTGGATT No data
Right 971077142 4:23163144-23163166 ATAGAATCTTTGGAGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971077138 Original CRISPR AATCCAAATCCACTTTTCAA CGG (reversed) Intergenic
No off target data available for this crispr