ID: 971077139

View in Genome Browser
Species Human (GRCh38)
Location 4:23163103-23163125
Sequence GTTGAAAAGTGGATTTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971077130_971077139 10 Left 971077130 4:23163070-23163092 CCTTCCACCCTTCCCTTATATAA No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data
971077134_971077139 -2 Left 971077134 4:23163082-23163104 CCCTTATATAAAAGCTAATCCGT No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data
971077131_971077139 6 Left 971077131 4:23163074-23163096 CCACCCTTCCCTTATATAAAAGC No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data
971077132_971077139 3 Left 971077132 4:23163077-23163099 CCCTTCCCTTATATAAAAGCTAA No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data
971077135_971077139 -3 Left 971077135 4:23163083-23163105 CCTTATATAAAAGCTAATCCGTT No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data
971077133_971077139 2 Left 971077133 4:23163078-23163100 CCTTCCCTTATATAAAAGCTAAT No data
Right 971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971077139 Original CRISPR GTTGAAAAGTGGATTTGGAT TGG Intergenic
No off target data available for this crispr