ID: 971077140

View in Genome Browser
Species Human (GRCh38)
Location 4:23163134-23163156
Sequence TGAACTTTGAATAGAATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971077138_971077140 10 Left 971077138 4:23163101-23163123 CCGTTGAAAAGTGGATTTGGATT No data
Right 971077140 4:23163134-23163156 TGAACTTTGAATAGAATCTTTGG No data
971077134_971077140 29 Left 971077134 4:23163082-23163104 CCCTTATATAAAAGCTAATCCGT No data
Right 971077140 4:23163134-23163156 TGAACTTTGAATAGAATCTTTGG No data
971077135_971077140 28 Left 971077135 4:23163083-23163105 CCTTATATAAAAGCTAATCCGTT No data
Right 971077140 4:23163134-23163156 TGAACTTTGAATAGAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971077140 Original CRISPR TGAACTTTGAATAGAATCTT TGG Intergenic
No off target data available for this crispr