ID: 971082285

View in Genome Browser
Species Human (GRCh38)
Location 4:23227239-23227261
Sequence ATTCACTTGCAGAATGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971082279_971082285 -7 Left 971082279 4:23227223-23227245 CCAATGGCGCCCACCCATTCACT No data
Right 971082285 4:23227239-23227261 ATTCACTTGCAGAATGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971082285 Original CRISPR ATTCACTTGCAGAATGAGTA GGG Intergenic
No off target data available for this crispr