ID: 971083541

View in Genome Browser
Species Human (GRCh38)
Location 4:23243913-23243935
Sequence TCTGGGGCCAAGAAGCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971083536_971083541 -2 Left 971083536 4:23243892-23243914 CCAGAAATGTGATTTACACCATC No data
Right 971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG No data
971083532_971083541 18 Left 971083532 4:23243872-23243894 CCTTTTCTCTCCAGCCACCACCA No data
Right 971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG No data
971083531_971083541 27 Left 971083531 4:23243863-23243885 CCTAGTTATCCTTTTCTCTCCAG No data
Right 971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG No data
971083534_971083541 4 Left 971083534 4:23243886-23243908 CCACCACCAGAAATGTGATTTAC No data
Right 971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG No data
971083535_971083541 1 Left 971083535 4:23243889-23243911 CCACCAGAAATGTGATTTACACC No data
Right 971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG No data
971083533_971083541 8 Left 971083533 4:23243882-23243904 CCAGCCACCACCAGAAATGTGAT No data
Right 971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971083541 Original CRISPR TCTGGGGCCAAGAAGCCCCA AGG Intergenic
No off target data available for this crispr