ID: 971084411

View in Genome Browser
Species Human (GRCh38)
Location 4:23254805-23254827
Sequence AATAGTAATTGCCATCCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971084409_971084411 5 Left 971084409 4:23254777-23254799 CCTTGCCAGGATTTCTTAGCATT No data
Right 971084411 4:23254805-23254827 AATAGTAATTGCCATCCTAACGG No data
971084410_971084411 0 Left 971084410 4:23254782-23254804 CCAGGATTTCTTAGCATTTAAAA No data
Right 971084411 4:23254805-23254827 AATAGTAATTGCCATCCTAACGG No data
971084406_971084411 20 Left 971084406 4:23254762-23254784 CCAATATCTCCACATCCTTGCCA 0: 3
1: 198
2: 1820
3: 21730
4: 13491
Right 971084411 4:23254805-23254827 AATAGTAATTGCCATCCTAACGG No data
971084408_971084411 11 Left 971084408 4:23254771-23254793 CCACATCCTTGCCAGGATTTCTT No data
Right 971084411 4:23254805-23254827 AATAGTAATTGCCATCCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971084411 Original CRISPR AATAGTAATTGCCATCCTAA CGG Intergenic
No off target data available for this crispr