ID: 971087934

View in Genome Browser
Species Human (GRCh38)
Location 4:23300952-23300974
Sequence CAGGTAAAACATTTTACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971087934_971087937 1 Left 971087934 4:23300952-23300974 CCCACAGTAAAATGTTTTACCTG No data
Right 971087937 4:23300976-23300998 TTTTTCATTACTAAACACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971087934 Original CRISPR CAGGTAAAACATTTTACTGT GGG (reversed) Intergenic
No off target data available for this crispr