ID: 971089330

View in Genome Browser
Species Human (GRCh38)
Location 4:23322133-23322155
Sequence ACATATATTCAAAAGTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971089328_971089330 -10 Left 971089328 4:23322120-23322142 CCTTATAAACCTTACATATATTC No data
Right 971089330 4:23322133-23322155 ACATATATTCAAAAGTTCACAGG No data
971089326_971089330 16 Left 971089326 4:23322094-23322116 CCCAAAACTTTCATTTAATATAC No data
Right 971089330 4:23322133-23322155 ACATATATTCAAAAGTTCACAGG No data
971089325_971089330 20 Left 971089325 4:23322090-23322112 CCTTCCCAAAACTTTCATTTAAT No data
Right 971089330 4:23322133-23322155 ACATATATTCAAAAGTTCACAGG No data
971089327_971089330 15 Left 971089327 4:23322095-23322117 CCAAAACTTTCATTTAATATACT No data
Right 971089330 4:23322133-23322155 ACATATATTCAAAAGTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971089330 Original CRISPR ACATATATTCAAAAGTTCAC AGG Intergenic
No off target data available for this crispr