ID: 971091208

View in Genome Browser
Species Human (GRCh38)
Location 4:23347700-23347722
Sequence CTCTGAAAAAGTCCACGGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971091206_971091208 2 Left 971091206 4:23347675-23347697 CCTATGATGTTATGACAATTCAT No data
Right 971091208 4:23347700-23347722 CTCTGAAAAAGTCCACGGTACGG No data
971091204_971091208 16 Left 971091204 4:23347661-23347683 CCATTAACCATTATCCTATGATG No data
Right 971091208 4:23347700-23347722 CTCTGAAAAAGTCCACGGTACGG No data
971091203_971091208 17 Left 971091203 4:23347660-23347682 CCCATTAACCATTATCCTATGAT No data
Right 971091208 4:23347700-23347722 CTCTGAAAAAGTCCACGGTACGG No data
971091205_971091208 9 Left 971091205 4:23347668-23347690 CCATTATCCTATGATGTTATGAC No data
Right 971091208 4:23347700-23347722 CTCTGAAAAAGTCCACGGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971091208 Original CRISPR CTCTGAAAAAGTCCACGGTA CGG Intergenic
No off target data available for this crispr