ID: 971092205

View in Genome Browser
Species Human (GRCh38)
Location 4:23359101-23359123
Sequence GTGTTGTTATTGCTGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971092198_971092205 19 Left 971092198 4:23359059-23359081 CCCTGGAGCTAACCTCCTCACTA No data
Right 971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG No data
971092203_971092205 4 Left 971092203 4:23359074-23359096 CCTCACTATCACTGGGTTGTGAA No data
Right 971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG No data
971092202_971092205 7 Left 971092202 4:23359071-23359093 CCTCCTCACTATCACTGGGTTGT No data
Right 971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG No data
971092199_971092205 18 Left 971092199 4:23359060-23359082 CCTGGAGCTAACCTCCTCACTAT No data
Right 971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971092205 Original CRISPR GTGTTGTTATTGCTGAACCA GGG Intergenic
No off target data available for this crispr