ID: 971095626

View in Genome Browser
Species Human (GRCh38)
Location 4:23399126-23399148
Sequence TAGCATGGCAATATTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971095626_971095629 4 Left 971095626 4:23399126-23399148 CCATGCACAATATTGCCATGCTA No data
Right 971095629 4:23399153-23399175 CAATTTTCACTTAAGGCCCAAGG No data
971095626_971095628 -3 Left 971095626 4:23399126-23399148 CCATGCACAATATTGCCATGCTA No data
Right 971095628 4:23399146-23399168 CTACTGTCAATTTTCACTTAAGG No data
971095626_971095630 5 Left 971095626 4:23399126-23399148 CCATGCACAATATTGCCATGCTA No data
Right 971095630 4:23399154-23399176 AATTTTCACTTAAGGCCCAAGGG No data
971095626_971095633 24 Left 971095626 4:23399126-23399148 CCATGCACAATATTGCCATGCTA No data
Right 971095633 4:23399173-23399195 AGGGCTCTTCAGTCAGCTTCTGG 0: 7
1: 121
2: 306
3: 461
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971095626 Original CRISPR TAGCATGGCAATATTGTGCA TGG (reversed) Intergenic
No off target data available for this crispr