ID: 971095780

View in Genome Browser
Species Human (GRCh38)
Location 4:23400197-23400219
Sequence ACATGGCCACTGCTGGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971095774_971095780 -1 Left 971095774 4:23400175-23400197 CCAAATGCAGATTCTCTACACCA No data
Right 971095780 4:23400197-23400219 ACATGGCCACTGCTGGAGGGCGG No data
971095773_971095780 2 Left 971095773 4:23400172-23400194 CCACCAAATGCAGATTCTCTACA No data
Right 971095780 4:23400197-23400219 ACATGGCCACTGCTGGAGGGCGG No data
971095772_971095780 5 Left 971095772 4:23400169-23400191 CCACCACCAAATGCAGATTCTCT No data
Right 971095780 4:23400197-23400219 ACATGGCCACTGCTGGAGGGCGG No data
971095770_971095780 7 Left 971095770 4:23400167-23400189 CCCCACCACCAAATGCAGATTCT No data
Right 971095780 4:23400197-23400219 ACATGGCCACTGCTGGAGGGCGG No data
971095771_971095780 6 Left 971095771 4:23400168-23400190 CCCACCACCAAATGCAGATTCTC No data
Right 971095780 4:23400197-23400219 ACATGGCCACTGCTGGAGGGCGG No data
971095769_971095780 8 Left 971095769 4:23400166-23400188 CCCCCACCACCAAATGCAGATTC No data
Right 971095780 4:23400197-23400219 ACATGGCCACTGCTGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971095780 Original CRISPR ACATGGCCACTGCTGGAGGG CGG Intergenic
No off target data available for this crispr