ID: 971100223

View in Genome Browser
Species Human (GRCh38)
Location 4:23458353-23458375
Sequence TTCCACAGGGGAGTGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971100223_971100228 22 Left 971100223 4:23458353-23458375 CCTCATGACACTCCCCTGTGGAA No data
Right 971100228 4:23458398-23458420 GATGGTACTAAAGATATTTAAGG No data
971100223_971100227 4 Left 971100223 4:23458353-23458375 CCTCATGACACTCCCCTGTGGAA No data
Right 971100227 4:23458380-23458402 TCTTATTATTATGACTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971100223 Original CRISPR TTCCACAGGGGAGTGTCATG AGG (reversed) Intergenic
No off target data available for this crispr