ID: 971101014

View in Genome Browser
Species Human (GRCh38)
Location 4:23466452-23466474
Sequence AGTTATCTGCAGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971101011_971101014 22 Left 971101011 4:23466407-23466429 CCAAAGCGCAGTAACAGGTCAAG No data
Right 971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG No data
971101013_971101014 -6 Left 971101013 4:23466435-23466457 CCTCTTAAAAGGAGAGTAGTTAT No data
Right 971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971101014 Original CRISPR AGTTATCTGCAGAAGATAGC AGG Intergenic
No off target data available for this crispr