ID: 971103225

View in Genome Browser
Species Human (GRCh38)
Location 4:23493247-23493269
Sequence GAGTCAATTTTATAACTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971103220_971103225 -9 Left 971103220 4:23493233-23493255 CCTGTGTGCCCCTTGAGTCAATT No data
Right 971103225 4:23493247-23493269 GAGTCAATTTTATAACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971103225 Original CRISPR GAGTCAATTTTATAACTGCT GGG Intergenic
No off target data available for this crispr