ID: 971103564

View in Genome Browser
Species Human (GRCh38)
Location 4:23497089-23497111
Sequence AGGTACTTACAGATGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971103557_971103564 27 Left 971103557 4:23497039-23497061 CCTCTAAGGAGGTTTAGAGAAGG No data
Right 971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971103564 Original CRISPR AGGTACTTACAGATGAAGAA GGG Intergenic
No off target data available for this crispr