ID: 971107865

View in Genome Browser
Species Human (GRCh38)
Location 4:23546742-23546764
Sequence TGTGATCCAAATGAATACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971107865_971107867 8 Left 971107865 4:23546742-23546764 CCAGAGTATTCATTTGGATCACA No data
Right 971107867 4:23546773-23546795 TAATCAAATACTGTTACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971107865 Original CRISPR TGTGATCCAAATGAATACTC TGG (reversed) Intergenic
No off target data available for this crispr