ID: 971115072

View in Genome Browser
Species Human (GRCh38)
Location 4:23636317-23636339
Sequence ATCTGTAAAGCAGATTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971115072_971115074 2 Left 971115072 4:23636317-23636339 CCTTAAAAATCTGCTTTACAGAT No data
Right 971115074 4:23636342-23636364 TTAGGTCAATAGTAATATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971115072 Original CRISPR ATCTGTAAAGCAGATTTTTA AGG (reversed) Intergenic
No off target data available for this crispr