ID: 971119365

View in Genome Browser
Species Human (GRCh38)
Location 4:23687113-23687135
Sequence GAGAATGGTTGGAAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971119358_971119365 9 Left 971119358 4:23687081-23687103 CCATTTCAAGGCTGCTGCCTACT No data
Right 971119365 4:23687113-23687135 GAGAATGGTTGGAAGGCTGCAGG No data
971119361_971119365 -8 Left 971119361 4:23687098-23687120 CCTACTAGGCAGGCAGAGAATGG No data
Right 971119365 4:23687113-23687135 GAGAATGGTTGGAAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971119365 Original CRISPR GAGAATGGTTGGAAGGCTGC AGG Intergenic
No off target data available for this crispr