ID: 971121287

View in Genome Browser
Species Human (GRCh38)
Location 4:23707656-23707678
Sequence TGAAACCCTGGTACAAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971121279_971121287 26 Left 971121279 4:23707607-23707629 CCCAATAGCACAATCATTCAATT No data
Right 971121287 4:23707656-23707678 TGAAACCCTGGTACAAGATGAGG No data
971121280_971121287 25 Left 971121280 4:23707608-23707630 CCAATAGCACAATCATTCAATTC No data
Right 971121287 4:23707656-23707678 TGAAACCCTGGTACAAGATGAGG No data
971121278_971121287 27 Left 971121278 4:23707606-23707628 CCCCAATAGCACAATCATTCAAT No data
Right 971121287 4:23707656-23707678 TGAAACCCTGGTACAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971121287 Original CRISPR TGAAACCCTGGTACAAGATG AGG Intergenic
No off target data available for this crispr