ID: 971126197

View in Genome Browser
Species Human (GRCh38)
Location 4:23757931-23757953
Sequence CAGGTTAGAGAGTGTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971126197 Original CRISPR CAGGTTAGAGAGTGTGTTGC AGG Intronic
900974671 1:6009503-6009525 CAGGCTGGACAGTGTGTTCCAGG - Intronic
901683367 1:10929246-10929268 CAAGAGAGAGAGTGTGTTCCAGG + Intergenic
905170169 1:36105228-36105250 GAGGTTACAGAGTGGGTTGGTGG - Intronic
906302968 1:44697071-44697093 CACGTTAAAGAGTGAGTTTCAGG - Intronic
907384794 1:54119004-54119026 CAGGAGAGGGTGTGTGTTGCGGG - Intergenic
907562706 1:55405555-55405577 CAGGCAAGAGAGTGTGTTCAGGG + Intergenic
907703547 1:56813366-56813388 CAGGTAAGAGAGTGTGTGCAGGG + Intronic
908933251 1:69341641-69341663 CAGGCAAGAGAGTGTGTTCAGGG - Intergenic
911739384 1:101370302-101370324 CAGGGCAGAGAGTGTGATGGAGG + Intergenic
912820913 1:112866999-112867021 AAGGTAAGAGAGTGTGCAGCCGG - Intergenic
916505375 1:165423683-165423705 TAGGTGAGTGTGTGTGTTGCTGG + Intronic
917647373 1:177042341-177042363 CAGGCTAGGGACTGTGCTGCTGG - Intronic
918254592 1:182737545-182737567 CAGGCAAGAGAGTGTGTGGAGGG - Intergenic
919356980 1:196536756-196536778 CAGGTTAGTGAGAGTGTGACAGG - Intronic
920778545 1:208965247-208965269 CAGTTTTGAGAGTTTGTTGGTGG + Intergenic
922700520 1:227756977-227756999 CAGGTTAGAGACTGTGAGTCAGG + Intronic
1068509523 10:57946630-57946652 CAGGTAAGAGAGTGTGTGCAAGG - Intergenic
1070708315 10:78657677-78657699 CTGGTTAGAAAGTGGGTTGAAGG - Intergenic
1071520080 10:86325334-86325356 CAGGATGGTGAGTGAGTTGCTGG - Intronic
1073112464 10:101070681-101070703 CTGGTTAGGGAGTGGGGTGCGGG + Intergenic
1073489554 10:103843945-103843967 CAGGTTAGAGAATGTATGGGTGG - Intronic
1074037345 10:109753695-109753717 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
1074917862 10:117974952-117974974 CAGATGAGAGGGTGTGTTTCTGG + Intergenic
1075957705 10:126538170-126538192 CAGGCAAGAGAGTGTGTTCAGGG + Intronic
1076175451 10:128364494-128364516 CAGGTGAGAGAGTAGGTTGATGG + Intergenic
1078987793 11:16612021-16612043 CAGGCTAGGGAGTGCGTGGCTGG + Intronic
1082832303 11:57627726-57627748 GAGATTAGAGCGTGTGTTGGGGG + Intergenic
1087463515 11:98474847-98474869 CAGGTAAGAGAGTGTATTCAGGG + Intergenic
1089540085 11:119184658-119184680 CAGGCAAGAGAGTGTGTGCCGGG + Intergenic
1091395508 12:152054-152076 CAAGACAGAGACTGTGTTGCTGG + Intronic
1091930045 12:4388789-4388811 CAGGAAAAAGAGTGTGTTGGCGG - Intergenic
1092912784 12:13162817-13162839 CAGGTTATAAATTCTGTTGCTGG + Intergenic
1096095568 12:48933318-48933340 CTGGAGAGAGAGTGTCTTGCTGG - Intronic
1096956415 12:55530312-55530334 CTGGTTAGCCAGGGTGTTGCCGG - Intergenic
1097797553 12:63880120-63880142 CAGGCTAGAGAGTGTGTGCAGGG - Intronic
1098008033 12:66019962-66019984 CAGGTTACAGAGTGCGTAACTGG - Intergenic
1098974760 12:76890913-76890935 CACGTTGGAGTGTGTGTTGTGGG + Intergenic
1099566893 12:84262204-84262226 CTGGTCAGAGAGGGTGTTTCTGG + Intergenic
1101202534 12:102451933-102451955 CAGGTGAGAGAGTGTGAAGAGGG - Intronic
1101560555 12:105853612-105853634 CAAGTTAGGGAGTGAGTTTCCGG - Intergenic
1101763795 12:107680891-107680913 CAGGTGAGAGAGTGTTTTGTAGG - Intergenic
1103136267 12:118510511-118510533 CAGGTAAGAGAGTGTGTGCAGGG + Intergenic
1107988280 13:45794631-45794653 CAGGCAAGAGAGTGTGTGGAGGG - Intronic
1108068681 13:46605271-46605293 TAGGTTACAGAGTGTTTTCCTGG + Intronic
1108276047 13:48810690-48810712 CAGGTTAGCAAGAGTATTGCAGG + Intergenic
1108383335 13:49875126-49875148 CAGGCAAGTGAGTGTCTTGCAGG + Intergenic
1108762106 13:53580538-53580560 CAGGCAAGAGAGTGTGTGGCAGG + Intergenic
1109469116 13:62780947-62780969 CAGGTTATAATGTGTGTTGTCGG - Intergenic
1109720728 13:66273065-66273087 CAGATCAGAGAGTGTGTGTCTGG - Intergenic
1109776127 13:67043231-67043253 CAGCTTGGAGATTGTATTGCTGG + Intronic
1110623103 13:77621350-77621372 CAAGTTAGAGGGTGTGTGGGTGG - Intronic
1111494381 13:89029158-89029180 CAGGCAAGAGAGTGTGTTCAGGG + Intergenic
1111568186 13:90044110-90044132 GAGGTTATAGAATGTGGTGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113591855 13:111506950-111506972 CAGGTTAGTGGGGGTGCTGCTGG - Intergenic
1114795876 14:25714283-25714305 CAGGTGAGAGAGTGTGTTCAGGG + Intergenic
1116354567 14:43912658-43912680 CAGGAGAGACAGAGTGTTGCGGG - Intergenic
1119414139 14:74458293-74458315 CAGGTTAGAAAGTGCTGTGCAGG + Intergenic
1119899343 14:78246548-78246570 GAGGTGAGAGAGGATGTTGCGGG + Intronic
1122055340 14:99094232-99094254 CATGTGAGTGTGTGTGTTGCTGG - Intergenic
1122371604 14:101232023-101232045 CAGGTCACAGAGTGTGGTGGTGG + Intergenic
1122455589 14:101848229-101848251 AACGTTAGAAAGTGTGTTGGGGG + Intronic
1126344260 15:47676080-47676102 AAGGAGAGAGAGTGTCTTGCTGG - Intronic
1127090042 15:55457678-55457700 CTGGCTAGACAGGGTGTTGCAGG - Intronic
1127131433 15:55868555-55868577 CAGGCAAGAGAGTGTGTGCCAGG - Intronic
1127920875 15:63493190-63493212 CAGGTTAGAAATTGTGCTCCTGG - Intergenic
1134007455 16:10827802-10827824 CTGGTGACAGGGTGTGTTGCTGG - Intergenic
1134126879 16:11622117-11622139 GTGGTTAGAGAGTGTGTTTGGGG + Intronic
1134290384 16:12899878-12899900 AAGCTTAGTGAGTATGTTGCAGG + Intergenic
1134434826 16:14246927-14246949 CAGGTTTGACAGAGTGCTGCTGG - Exonic
1142748397 17:1972540-1972562 GAGGGTAGAGAGGGCGTTGCAGG - Intronic
1145777847 17:27541629-27541651 CAGCTTAGGGTGTGGGTTGCAGG + Intronic
1146373260 17:32278420-32278442 CAGGTCAGAGAGTGAGTTCGCGG - Intronic
1147375784 17:40021834-40021856 CTGGTCAGAGAGGGTGTGGCAGG - Intronic
1156917711 18:42481096-42481118 CAACTTGGAGAGTGTGTTACTGG - Intergenic
1158861916 18:61600881-61600903 CAGGTTAGAGAGGGGGTGGAAGG + Intergenic
1161381669 19:3968751-3968773 CAGGCTAGGGAGAGTGCTGCAGG - Intronic
1166419550 19:42625960-42625982 TGGGTTAGAGGCTGTGTTGCAGG + Intronic
1166734279 19:45075424-45075446 CAGGTTGGGGTGTGTGTTGGGGG + Intronic
1167479424 19:49720487-49720509 CAGGTTATAAAGGGTGTGGCTGG - Intergenic
1167606688 19:50485081-50485103 CTGGTGTAAGAGTGTGTTGCTGG + Exonic
925768115 2:7257563-7257585 CAGGATAGGGAGTGTGTGGGTGG - Intergenic
925916534 2:8610965-8610987 CAGGCAAGAGAGTGTGTGCCAGG + Intergenic
926436818 2:12846662-12846684 GAGGTTAGAGAGTGAGAGGCAGG + Intergenic
926775079 2:16414112-16414134 AGGGTTAGAGAGTGTGGGGCAGG + Intergenic
926886588 2:17604156-17604178 CAGGGCAGAGGGTGTGGTGCAGG + Intronic
926945079 2:18178624-18178646 TTGGTTAGAGACTGTGTTGTTGG - Intronic
927719731 2:25374923-25374945 CAGGGGAGAGGGGGTGTTGCAGG - Intergenic
928815702 2:35292462-35292484 CTGGTTAGACAGAGTGCTGCAGG + Intergenic
929861868 2:45684982-45685004 CTGGTTAGAAAGTCTGTTCCTGG + Intronic
931462675 2:62462200-62462222 GAGGTCAGAGAGTGTGATGTGGG - Intergenic
931828545 2:66026593-66026615 GAGATTAGAGAGTGTGTTCCTGG - Intergenic
938259978 2:129888586-129888608 CAGGTCTGAGTGTGTTTTGCTGG - Intergenic
939305186 2:140401841-140401863 CTGGTTAGCCAGGGTGTTGCAGG - Intronic
939550897 2:143614125-143614147 CAGGTGAGTGAGGGTGGTGCAGG - Intronic
941644898 2:168029860-168029882 CACCTAAGAGAGTGGGTTGCTGG + Intronic
941713773 2:168742786-168742808 CAGATTAGGGACTGTGTTGTGGG + Intronic
942209655 2:173657933-173657955 CAGGTAAAAGAGGGAGTTGCTGG + Intergenic
943607809 2:189997114-189997136 CTGGTTAGCCAGGGTGTTGCAGG + Intronic
944296573 2:198069983-198070005 AAGATTTGGGAGTGTGTTGCGGG + Intronic
944665111 2:201953320-201953342 CAGCTTAGTGAGTGTGGGGCAGG + Intergenic
945012738 2:205482334-205482356 GAGGTTAGGGAGAGTTTTGCTGG + Intronic
946028659 2:216688017-216688039 CAGGTGAGAGAGGGGTTTGCTGG + Intronic
947295188 2:228623072-228623094 CAGGTTAGACAGGCAGTTGCTGG - Intergenic
947650831 2:231785105-231785127 TAGATAAGAGATTGTGTTGCCGG - Intronic
947767045 2:232644456-232644478 CAGGTGTGAGTGTGTGTTGGGGG + Intronic
948765136 2:240215607-240215629 CAGGTTCCAGAGTGTGATGTGGG + Intergenic
1169405022 20:5315658-5315680 CAGGTTAGGGTGTCTTTTGCTGG - Intergenic
1169839265 20:9916468-9916490 CAAGTTAGAAATTTTGTTGCAGG + Intergenic
1171305809 20:24104904-24104926 CTGGGTATAGAGTGTGCTGCTGG + Intergenic
1172500907 20:35426440-35426462 GAAGTTAAAGAGTGTGGTGCTGG - Intergenic
1173117764 20:40262548-40262570 GAGAATAGCGAGTGTGTTGCAGG - Intergenic
1175555697 20:59854379-59854401 CAAGCAAGAGAGTGAGTTGCAGG - Intergenic
1176910247 21:14556941-14556963 TTGGTTGGAGAGGGTGTTGCTGG - Intronic
1177735325 21:25081976-25081998 CAGGTTATTGTGTGTGTTGGGGG - Intergenic
1178233304 21:30812526-30812548 CAGGTAAGAGGGTGGGTTGCAGG - Intergenic
1179605295 21:42512398-42512420 CAGCTTAAAGAGTGGATTGCAGG + Intronic
1179821445 21:43939569-43939591 CAGTTTGGAGAGAGTGTCGCGGG + Intronic
1180896357 22:19336507-19336529 CTGGTTAGAAAGGATGTTGCAGG - Intronic
1181583191 22:23839016-23839038 CGGGTTAAAGAGCGCGTTGCTGG - Intronic
1181624650 22:24114963-24114985 CTGGTTAGAGAGTGGGGTGGTGG - Intronic
1182869259 22:33632068-33632090 AAGGGTAGAGAGTGAGTTGGAGG - Intronic
1183061399 22:35338493-35338515 GAGGTTAGGGAGGGTGTTGCTGG - Intronic
949145998 3:700874-700896 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
949749365 3:7333127-7333149 CAGGTTAGCCAGGGTGTTGCAGG - Intronic
950516771 3:13471610-13471632 CTGGTTAGCTAGAGTGTTGCAGG + Intergenic
954038550 3:47867066-47867088 CATGTTAGACAGGGTGTTTCTGG - Intronic
955084347 3:55688253-55688275 CAGGTTAGAAAGAGTGCTGACGG + Intronic
957529823 3:81426875-81426897 TAGGTTAGAAATTGTGTTGCTGG - Intergenic
958768192 3:98395832-98395854 CTGGTTAGCCAGTGTGTTGCAGG - Intergenic
960557297 3:119043523-119043545 CTGGTTAGCTAGGGTGTTGCCGG - Intronic
962637827 3:137349036-137349058 CAGCTTAGACTGTGTGTTCCAGG + Intergenic
963410733 3:144924018-144924040 GATTTTAGAGTGTGTGTTGCGGG - Intergenic
966170394 3:177073802-177073824 AAGGAAAGACAGTGTGTTGCGGG - Intronic
967504638 3:190239618-190239640 CTGGTTAGCCAGAGTGTTGCAGG - Intergenic
970013715 4:11489187-11489209 TAGGTTTGAGTGTGTGTTTCAGG + Intergenic
970146794 4:13044363-13044385 CAGGCAAGAGAGTGTGTTCAGGG + Intergenic
970509271 4:16764595-16764617 CAAGCTAGAGTCTGTGTTGCAGG - Intronic
971126197 4:23757931-23757953 CAGGTTAGAGAGTGTGTTGCAGG + Intronic
973749285 4:53997160-53997182 AAAGTTTGAAAGTGTGTTGCGGG - Intronic
974534338 4:63154998-63155020 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
975284886 4:72606101-72606123 CAGGAAAGAGAGTGTGTTCAGGG - Intergenic
976268590 4:83207904-83207926 CAGGTTAGAATGTTTATTGCAGG - Intergenic
977433153 4:96957623-96957645 CAGGCAAGAGAGTGTGTGGAGGG - Intergenic
978049506 4:104180077-104180099 CAGGAAAGAGAGTGTGTTCAAGG + Intergenic
982049917 4:151490126-151490148 CTGGTTAGCCAGGGTGTTGCAGG - Intronic
982853887 4:160356143-160356165 CAGGTTAAAAGGTGTGTTGTGGG + Intergenic
983661564 4:170134894-170134916 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
983894240 4:173064492-173064514 CAGGCAAGAGAAAGTGTTGCGGG - Intergenic
984020073 4:174474845-174474867 CTGGTTAGCGAGGGTGATGCAGG - Intergenic
984736631 4:183114730-183114752 GTGGGTAGATAGTGTGTTGCGGG + Intronic
986642626 5:9887588-9887610 CAGGTGATAGAGTGTGGTTCAGG - Intergenic
987590301 5:19916493-19916515 CAGGTTAGAAAGTGTGGAGAAGG - Intronic
988260694 5:28882932-28882954 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
988278487 5:29113997-29114019 CTGGTTAGCCAGAGTGTTGCAGG + Intergenic
990005428 5:50939293-50939315 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
991414666 5:66379777-66379799 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
993365996 5:87035048-87035070 CTGGTTAGCTAGTATGTTGCAGG + Intergenic
993606772 5:90000640-90000662 CTGGTTAGTCAGTGTGTTGAAGG - Intergenic
993613755 5:90085059-90085081 CTGGCTAGCCAGTGTGTTGCAGG - Intergenic
995703906 5:114965251-114965273 CAGGTGAGAGATTGTGTTCAGGG - Intergenic
995884992 5:116884339-116884361 CAGGTCTGAGAGTGACTTGCTGG - Intergenic
997435051 5:133867869-133867891 GAGATTAGGGTGTGTGTTGCAGG - Intergenic
997566970 5:134895449-134895471 CAGGTTAGGGAGGGAGTTGCGGG - Intronic
997868242 5:137483726-137483748 CTGGTTGGAGAGTGTGCTACTGG - Intronic
1002941560 6:1720966-1720988 CAGGCTGGTGAGTGTGTTGAGGG + Intronic
1003098710 6:3160792-3160814 CAGACTAGAGAATGTGTTCCAGG + Intergenic
1004019088 6:11760250-11760272 CAGTTTTGAGAGTGTGTGGGGGG - Intronic
1006434579 6:34019572-34019594 CTGGTTAGAAAGTGTGCTGTGGG + Intronic
1006983214 6:38162069-38162091 CAGGTTCCAGAGGGTGTTGCTGG + Intergenic
1007920359 6:45603814-45603836 CAGGCAAGAGAATGTGTGGCAGG + Intronic
1008250875 6:49238261-49238283 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
1008496119 6:52136201-52136223 CAGGTGGGAGAGTGTGCTGGGGG + Intergenic
1012525654 6:100174533-100174555 CATGTTTGAGAGTATGTTGATGG + Intergenic
1012869878 6:104659829-104659851 CTGGTTAGTCAGGGTGTTGCAGG - Intergenic
1012965672 6:105670022-105670044 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1015620467 6:135126754-135126776 CTGGTTAGCCAGAGTGTTGCAGG - Intergenic
1017970596 6:159309395-159309417 CAGGTTAAAGATGGTGATGCAGG - Intergenic
1018245020 6:161814473-161814495 CAGGTAAGAGAGTGTGTGCAGGG + Intronic
1018628333 6:165801802-165801824 CAGGATTGAGAGAGTGGTGCAGG + Intronic
1018998965 6:168730914-168730936 TAGTTTAGAAAGTGTCTTGCTGG - Intergenic
1020015629 7:4829751-4829773 CAGGCGAGAGAGTGTGTTCAGGG - Intronic
1020450445 7:8315497-8315519 CTGGTTAGCGAGAGTGATGCAGG + Intergenic
1023498855 7:40827258-40827280 AAGGTGATAGGGTGTGTTGCTGG + Intronic
1024270772 7:47639748-47639770 GAGGTTAGAGTGTGTGATGGTGG + Intergenic
1024300817 7:47886192-47886214 CAGGGCAGAGAGTGTGGTGTTGG + Intronic
1027399651 7:77794379-77794401 CAGTTTAAAGAGGCTGTTGCAGG + Exonic
1030050383 7:105532229-105532251 CTGGGTAGTGAGTGTGTCGCTGG + Exonic
1031493614 7:122420058-122420080 GAGGTTATACAGTTTGTTGCTGG + Intronic
1031764653 7:125762918-125762940 CAGGCAAGAGAGCTTGTTGCAGG - Intergenic
1031818907 7:126473860-126473882 CAGGCAAGAGAGTGTGTTCAGGG - Intronic
1035931208 8:3782357-3782379 CAGGTTAAAGATTGACTTGCCGG - Intronic
1036117065 8:5970286-5970308 CATGTTGGAGTGTGTGTTGGTGG - Intergenic
1038289833 8:26239206-26239228 CAGGCAAGAGAGCATGTTGCAGG + Intergenic
1038426875 8:27469496-27469518 CAGGTTTCAGAGTGGGTGGCGGG - Intronic
1046410040 8:113830168-113830190 CAATTTAGAGAGTGTTTTGAAGG + Intergenic
1051273253 9:15375198-15375220 CTGGTTAGCTAGGGTGTTGCAGG - Intergenic
1052538104 9:29773674-29773696 CAATTTAGAGAGTGCTTTGCAGG - Intergenic
1055689716 9:78816459-78816481 CAGGGGATAGAGTGTGTTCCTGG + Intergenic
1055774239 9:79751138-79751160 CAGGCAAGAGAGTGTGTTCAAGG + Intergenic
1056309490 9:85324631-85324653 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1058041912 9:100311963-100311985 CAGATTTGAGAGTGTGTGGGGGG + Intronic
1058810164 9:108631323-108631345 CAGGTAAGAGAGCGTGTTCAGGG - Intergenic
1060198503 9:121638478-121638500 GAGCTCAGAGAGAGTGTTGCAGG + Intronic
1061441391 9:130606393-130606415 CAGGTGAGTGAGTCTGTTGGGGG - Intronic
1062221410 9:135418061-135418083 CAGGTGATTGAGTGTGTTGGTGG + Intergenic
1192171395 X:68857456-68857478 GAGGGTAGAGAGTGTGTTGGTGG + Intergenic
1192593464 X:72382105-72382127 CAGGTTAGACAGTTTATTGTAGG - Intronic
1192853414 X:74981412-74981434 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1192981668 X:76350782-76350804 CTGGTTAGCCAGTGTGTTGCAGG - Intergenic
1194353798 X:92855869-92855891 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1194397401 X:93403186-93403208 CAGGCAAGAGAGTGTGTTTAGGG + Intergenic
1196599449 X:117585056-117585078 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
1197600117 X:128518354-128518376 CAGGTTGTGGAGTATGTTGCTGG - Intergenic
1197603778 X:128560936-128560958 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1198967020 X:142237896-142237918 CAGGTAAGAGAGTGTGTGCAGGG - Intergenic
1199177415 X:144806986-144807008 CAGGATAGAGAGTGTGTGCAGGG + Intergenic
1199528996 X:148825945-148825967 CAGGTTTGTGAGTGTGTTGCGGG + Intronic
1200662158 Y:5972941-5972963 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic