ID: 971128543

View in Genome Browser
Species Human (GRCh38)
Location 4:23780494-23780516
Sequence CTTTGAGTTTGTAAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971128543_971128547 -10 Left 971128543 4:23780494-23780516 CCAGCATCCTTACAAACTCAAAG 0: 1
1: 0
2: 1
3: 9
4: 208
Right 971128547 4:23780507-23780529 AAACTCAAAGGGCAAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971128543 Original CRISPR CTTTGAGTTTGTAAGGATGC TGG (reversed) Intronic
900089946 1:915858-915880 CCTTGAATTTGTGAGGATGGTGG - Intergenic
902963668 1:19982375-19982397 CTAAGAGTTTTTAAGGATTCAGG - Intergenic
904061398 1:27713767-27713789 CTGTGAGTTTTTAAGGATTCGGG - Intergenic
908078554 1:60548142-60548164 CTTTGAGTGGCTCAGGATGCAGG - Intergenic
908951813 1:69569430-69569452 CTCCGAGTTATTAAGGATGCAGG + Intronic
909572107 1:77126280-77126302 CTGTGACTTTGTAAAGGTGCTGG + Intronic
914046646 1:144099276-144099298 CTATGTGTTTTTAAGGAGGCCGG + Intergenic
914131464 1:144861410-144861432 CTATGTGTTTTTAAGGAGGCCGG - Intergenic
917544274 1:175946984-175947006 TATTGAGGTTGTATGGATGCTGG - Intronic
918085819 1:181244342-181244364 CTTTGTGTTAGTAAGGATGCAGG + Intergenic
918654371 1:187006110-187006132 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
920070802 1:203301659-203301681 TTTAGAGTTTCTAAGGATTCTGG + Intergenic
920281164 1:204844801-204844823 CTGAGAGTTTTTAAGGATTCTGG + Intronic
920610155 1:207428125-207428147 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
920923144 1:210314953-210314975 CTTTGCCTTTGAAAGGTTGCTGG - Intergenic
922083358 1:222320309-222320331 CTTTGCTTTTGGCAGGATGCTGG - Intergenic
922381763 1:225036439-225036461 CTAAGAGTTTTTAAGGATTCAGG + Intronic
923292176 1:232556898-232556920 CTTTGAGATTTTCAGGATGGAGG + Intronic
924699574 1:246437926-246437948 CTTAAAGTTTGTCAGAATGCTGG + Intronic
1063102278 10:2961191-2961213 CTTTGAGATTTGAAGGATGATGG - Intergenic
1065404850 10:25352083-25352105 CTTTTAGTTTGGGAGGTTGCAGG - Intronic
1070836091 10:79447672-79447694 CTTTGAGCTTCCAAGGATGGAGG + Intergenic
1071892615 10:90028168-90028190 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
1072725780 10:97812733-97812755 CTTTGAGTCGGATAGGATGCAGG + Intergenic
1074209501 10:111316862-111316884 CTGTGAGTTTGTGTGGCTGCAGG - Intergenic
1074874979 10:117606704-117606726 CTTAGAGGGTGCAAGGATGCAGG + Intergenic
1083354317 11:62054471-62054493 CTCTGAGCTTGTCAGGATGTAGG - Intergenic
1085343226 11:75747533-75747555 TTTTGTGTGTGTAGGGATGCGGG - Intergenic
1087270034 11:96101656-96101678 CTTTGAGCTTGGAATAATGCTGG - Intronic
1087997512 11:104828442-104828464 CTTGGAGTCTGTTAGAATGCTGG - Intergenic
1088678445 11:112219081-112219103 CTAAGAGTTTTTAAGGATTCAGG + Intronic
1088731418 11:112687223-112687245 CTTTGAGCTTTTAAGGAAGGGGG - Intergenic
1089359991 11:117879347-117879369 CTTTGGGCTTGTAAAGAAGCAGG - Intergenic
1090342361 11:126035702-126035724 TTTTGAGTTTTCAAGGGTGCAGG - Intronic
1094272279 12:28630083-28630105 CTTTTAGGTTGAAATGATGCTGG - Intergenic
1094455080 12:30622922-30622944 CTATGAGTTTAGAAGCATGCAGG - Intergenic
1097798817 12:63890706-63890728 CTTTGATTTTGCAGGGATGGGGG - Intronic
1099721545 12:86367491-86367513 CTAAGAGTTTTTAAGGATTCAGG - Intronic
1099781483 12:87201236-87201258 ATTTGGCTCTGTAAGGATGCAGG + Intergenic
1100346740 12:93738991-93739013 ATGTGACTTTGAAAGGATGCAGG + Intronic
1100366541 12:93926309-93926331 CTAAGAGATTGTAAGGATTCAGG - Intergenic
1100745722 12:97643614-97643636 CTTTGGCTTTGATAGGATGCAGG + Intergenic
1101553322 12:105783851-105783873 CTTTGAATTTGGATGGGTGCTGG + Intergenic
1101681996 12:106977958-106977980 CTTTGAGTTTGGATAGAAGCTGG + Exonic
1102161497 12:110772720-110772742 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
1102291918 12:111707840-111707862 CTGGGAGTTTGTAAAGATGCTGG + Intronic
1105435408 13:20373204-20373226 CTTTGGGTTTGTCATGATCCTGG - Intergenic
1106110151 13:26770015-26770037 CTTTGAGTGTGTAATGTTGAAGG - Intergenic
1106249141 13:27970963-27970985 CTTCGTGTTTGTAAGGAAGAAGG + Exonic
1107981665 13:45739887-45739909 TTTTGAGCCTGTAAGGAAGCGGG - Intergenic
1108116071 13:47129482-47129504 CTTTAAGTATTTCAGGATGCTGG - Intergenic
1110580277 13:77113804-77113826 ATTTGTATTTGTAGGGATGCTGG + Intronic
1111573492 13:90118473-90118495 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
1114214147 14:20643132-20643154 CTAGGAGTTTTTAAGGATTCAGG - Intergenic
1114407284 14:22468649-22468671 CTGTGAGTGTTTCAGGATGCAGG - Intergenic
1118121733 14:62853219-62853241 CTTAGAGACTGCAAGGATGCTGG - Intronic
1118309108 14:64679741-64679763 CTTTGCGTTTTTAAGAATGGAGG + Intergenic
1120142994 14:80949307-80949329 CTGAGAGTTTGGAAAGATGCAGG + Intronic
1121295221 14:92815411-92815433 CTTTTAGTTTGTAAGGCAGAGGG + Intronic
1122386722 14:101353412-101353434 CTTTGAATATGTAAGAATTCAGG - Intergenic
1124136076 15:27037451-27037473 CTAAGAGTTTGTAAGGATTCAGG + Intronic
1124479066 15:30061809-30061831 CTTTGAGTTTCTAAGGCTTTTGG - Intergenic
1125122489 15:36178587-36178609 CTCTGAGTTTGTAAGACTTCAGG + Intergenic
1131660024 15:94504634-94504656 CTTTTAGTTTTTAATGATTCTGG - Intergenic
1131782740 15:95877199-95877221 CTTTCAGTTTTTAAGGATCCTGG - Intergenic
1133354943 16:5129253-5129275 CTTTAAGTATGTTTGGATGCTGG + Intergenic
1136388186 16:29943606-29943628 CAAAGAGTTTGTAAGGATTCAGG - Intronic
1138648395 16:58442125-58442147 CTCAGAGTTTTTAAGGATTCAGG - Intergenic
1138967515 16:62103075-62103097 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
1146633849 17:34489779-34489801 CTTGGAGTTTGGAAGGTTGGGGG + Intergenic
1147519309 17:41154230-41154252 CTAAGAGTTTTTAAGGATTCAGG - Intergenic
1147873541 17:43604658-43604680 CTAAGAGTTTTTAAGGATTCAGG - Intergenic
1149366752 17:55952824-55952846 CTAAGAGTTTTTAAGGATTCAGG - Intergenic
1152968437 18:138479-138501 ATCTGAGTTTGTGAGGATACTGG + Intergenic
1153614992 18:6926032-6926054 CTAAGAGTTTTTAAGGATTCAGG - Intergenic
1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG + Intronic
1157754909 18:50209254-50209276 CTTTGTGTCTGTAACCATGCAGG - Intergenic
1157791279 18:50533404-50533426 CTTTGCTGTTGTAAGGATGGTGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158495175 18:57948909-57948931 CTTTGAGTTTGTGAGAAAACTGG - Intergenic
1158917002 18:62142874-62142896 CATTGCATTTGTAAGGTTGCTGG + Intronic
1161571193 19:5031686-5031708 CTTTGCTTTTGTCAGGATGGAGG + Intronic
1161872703 19:6882628-6882650 CCTTGAGCATGTAGGGATGCTGG - Intergenic
1163725044 19:18918321-18918343 CTAAGAGTTTTTAAGGATTCAGG - Intronic
1164004222 19:21134208-21134230 TTTTGAGTTTTTTAGAATGCAGG + Intergenic
1164544575 19:29149248-29149270 CTTAGATATTGTAAGAATGCTGG + Intergenic
1164563426 19:29309541-29309563 CTGTGGGTTTGTAACGATGGGGG - Intergenic
1165248427 19:34511659-34511681 CCTAGGGTTGGTAAGGATGCGGG - Exonic
1167774850 19:51548217-51548239 CTAAGAGTTTTTAAGGATTCAGG - Intergenic
1202686200 1_KI270712v1_random:52690-52712 CTATGTGTTTTTAAGGAGGCCGG + Intergenic
925517321 2:4697455-4697477 TTTTAAATATGTAAGGATGCAGG - Intergenic
927987539 2:27423175-27423197 CTCAGTGTTGGTAAGGATGCAGG - Intergenic
928418175 2:31114062-31114084 CTAAGAGTTTTTAAGGATTCAGG - Intronic
928872450 2:35996661-35996683 CTTTGAGTTTCTATGTATCCTGG + Intergenic
930599163 2:53424060-53424082 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
934245523 2:90302130-90302152 CTATGTGTTTTTAAGGAGGCCGG - Intergenic
934263223 2:91494909-91494931 CTATGTGTTTTTAAGGAGGCCGG + Intergenic
935050677 2:99522522-99522544 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
935960499 2:108421121-108421143 CTTTAAGTTTGTAAGTAGACTGG - Intergenic
936099670 2:109564496-109564518 CTGTGACTTTGTAAAGCTGCGGG - Exonic
936230418 2:110695494-110695516 CTAAGAGTTTTTAAGGATTCAGG - Intergenic
937040537 2:118817279-118817301 CACTGAGTTTTGAAGGATGCAGG - Intergenic
940642503 2:156361141-156361163 CCTGGGGTTTGGAAGGATGCAGG - Intergenic
941438090 2:165496800-165496822 CTAGGAGGTTGTAAGCATGCTGG - Intronic
941820495 2:169839990-169840012 CTAAGAGTTTTTAAGGATTCAGG + Intronic
941870341 2:170377709-170377731 TTATGAGTTTGTAAGTATGTTGG - Intronic
945203068 2:207304408-207304430 CTTTGAGTTTTAAAGAATACTGG - Intergenic
947063415 2:226192235-226192257 CTTTGACTTTGGATGGATGTGGG + Intergenic
947567363 2:231203023-231203045 CTAAGAGTTTTTAAGGATTCAGG - Intronic
947960702 2:234234414-234234436 CTCAGGGTTGGTAAGGATGCAGG + Intergenic
948706585 2:239797120-239797142 CTTGGAGTTTGTAACTTTGCTGG + Intronic
948745255 2:240087441-240087463 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
1169314970 20:4582821-4582843 CTTTGGGTTAGAAAGGATGCTGG + Intergenic
1169956414 20:11108145-11108167 CTGTCAGCTTGTAAGGTTGCTGG - Intergenic
1172021518 20:31917875-31917897 CTAAGAGTTTTTAAGGATTCAGG + Intronic
1172172704 20:32950525-32950547 CTAAGAGTTTTTAAGGATTCAGG + Intronic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1173457783 20:43217201-43217223 CTTTGGGTTTCTAAGGAATCTGG + Intergenic
1173471129 20:43324392-43324414 CTGTGAGTCTGTTAGGCTGCAGG + Intergenic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1174876064 20:54227511-54227533 CTTTGACCTGGTAAGGATGCAGG - Intronic
1175138648 20:56843389-56843411 CTTTGAGTCTGTATGGTTCCTGG + Intergenic
1176787935 21:13281561-13281583 CTTTGAGATTGAAAGGATAATGG - Intergenic
1177987066 21:27989752-27989774 CTTTGAGATTGAAAGGATAATGG - Intergenic
1179809335 21:43860521-43860543 CTTTGGGCTTTTAAGAATGCCGG + Intergenic
1184433402 22:44454922-44454944 CTTTGTGTTTATATGGATGTAGG + Intergenic
949108776 3:233044-233066 CTTTAAGGTTTCAAGGATGCTGG - Intronic
950248651 3:11445404-11445426 CGATGAGTTTGTAAGGATAAAGG - Intronic
950610073 3:14120921-14120943 CTAAGAGTTTTTAAGGATTCAGG + Intronic
954608909 3:51933987-51934009 CAGTGAGTTTGTGAGGATGAAGG + Intronic
954832554 3:53434930-53434952 TTTTGAGTTTATAAGAATGGTGG + Intergenic
955794419 3:62620892-62620914 CTTTGCCTCTGTCAGGATGCAGG + Intronic
956525585 3:70156083-70156105 CTTTCTGTTTGGAAGGAGGCAGG - Intergenic
962841149 3:139233798-139233820 CTTTGAGTTGACAAGAATGCGGG - Intronic
964936776 3:162098901-162098923 CTTTGAATTTGTAAAAATGCTGG - Intergenic
965136562 3:164779402-164779424 CTTTGTGTTTCTAAGAATGTAGG - Intergenic
965158830 3:165103789-165103811 TTATGAGTCTGTAAGAATGCAGG - Intergenic
965492889 3:169361454-169361476 CCTTGACTTTGGAAGGATGATGG + Intronic
966235351 3:177695486-177695508 CTTTGAGCTTGTAGGAAGGCCGG + Intergenic
968760664 4:2441592-2441614 CTCTGAGTTGGTAAGTGTGCAGG - Intronic
971128543 4:23780494-23780516 CTTTGAGTTTGTAAGGATGCTGG - Intronic
971130274 4:23801246-23801268 CTTTGTGTGTGTATGTATGCAGG - Intronic
972210842 4:36835090-36835112 ATTTGAGTGTGTGAGGTTGCTGG - Intergenic
974863513 4:67552207-67552229 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
975668509 4:76756633-76756655 CTTTGAGTCTGGATGGGTGCTGG - Exonic
977302658 4:95285796-95285818 GTTTCTGTGTGTAAGGATGCGGG + Intronic
980968954 4:139551316-139551338 CTCTGTGTTTTTAAGGTTGCCGG + Intronic
981292090 4:143088229-143088251 CCCTGAGTTTGTCATGATGCTGG - Intergenic
982389402 4:154848225-154848247 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
982802699 4:159723479-159723501 CCTTGAGTGTGCAGGGATGCTGG + Intergenic
983165259 4:164468543-164468565 GTTTGAGTTTGCAAGGTGGCCGG + Intergenic
985356875 4:189130311-189130333 CTGTGGCTTTATAAGGATGCAGG + Intergenic
991973117 5:72160012-72160034 CTTTTAGTTTGTATGGAGGAGGG + Intronic
992985875 5:82229097-82229119 CCTTGCCTTTGTAGGGATGCTGG + Intronic
994523259 5:100869678-100869700 CTTGGAGTTTGTTAGCATGTTGG - Intronic
994643150 5:102435508-102435530 CTTTGAGTATATAAGGTAGCAGG + Intronic
994652461 5:102545855-102545877 AATTGAGTTTGGAAGGAAGCAGG + Intergenic
995714383 5:115067964-115067986 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
996546467 5:124684177-124684199 CTTTAAGTCTGAAACGATGCTGG + Intronic
997673758 5:135697150-135697172 ATTTGAGTTAGAAATGATGCTGG + Intergenic
997747242 5:136310065-136310087 GACTGAGTCTGTAAGGATGCAGG - Intronic
997843225 5:137261464-137261486 ATTTGAGTTTGTCAGGATCTTGG + Intronic
1000115511 5:158149911-158149933 CTGTGAGGATGTGAGGATGCAGG + Intergenic
1007572327 6:42901917-42901939 CTTTGAGGTTGTAATGTTACAGG + Intergenic
1009801518 6:68543282-68543304 CTTTGAATTTTTCAGGATTCTGG + Intergenic
1012545643 6:100416108-100416130 CTAAGAGTTTTTAAGGATTCAGG - Intronic
1015416155 6:132950994-132951016 CTTTGAGTTTTCAAGGATTTAGG - Intergenic
1017523265 6:155220534-155220556 CAGTGAGGTTGGAAGGATGCAGG + Intronic
1018609497 6:165633924-165633946 ATTTGAATTTATAAGGATTCAGG - Intronic
1018684756 6:166295442-166295464 CTAAGAGTTTTTAAGGATTCAGG - Intergenic
1020784197 7:12554529-12554551 TTGTAAGTTTGTAAGGCTGCAGG + Intergenic
1024141466 7:46466993-46467015 CTTTGGATCTGTAAGGATGATGG + Intergenic
1024754554 7:52514646-52514668 CTTTGAATTTGTTAGGGTGCAGG + Intergenic
1026202476 7:68226254-68226276 CTGTGAGTTGGAAAGGATGAAGG - Intergenic
1028906391 7:96159217-96159239 CTTTCAGTTTGTGAGGACTCAGG - Intronic
1032769165 7:135031645-135031667 CTTTGATTTTGTATAGAGGCAGG + Intronic
1033580701 7:142731321-142731343 CTTTGAGTTTACCTGGATGCTGG + Intergenic
1033675271 7:143535064-143535086 CTCTGAGTTTCCCAGGATGCTGG - Intergenic
1033696566 7:143794374-143794396 CTCTGAGTTTCCCAGGATGCTGG + Intergenic
1034151148 7:148916364-148916386 CTTTAACTTTGTAAGGCTTCTGG - Intergenic
1035272338 7:157727922-157727944 CTCTGAGTGTGGAAGGATGGAGG - Intronic
1035621793 8:1040944-1040966 CTTTTAGTCTGTAAAGGTGCAGG + Intergenic
1037392574 8:18409387-18409409 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
1041307464 8:56477294-56477316 CTGTGACTTTGTAAAGCTGCGGG - Intergenic
1041721678 8:60981801-60981823 CTTGGTGTTTGTAAGGATGGAGG + Intergenic
1043021740 8:75010374-75010396 CTTTGATTTTTAAAGGATACAGG - Intronic
1043851503 8:85221324-85221346 CTAAGAGTTTTTAAGGATTCAGG + Intronic
1045420278 8:102007799-102007821 CTTTGAGTTTCCAAGAAGGCAGG + Intronic
1045944322 8:107778561-107778583 CTTTCAGTTGTTAAGAATGCAGG - Intergenic
1047063625 8:121255371-121255393 CTTTGAGGATGGAAGGATGGGGG + Intergenic
1047637387 8:126779364-126779386 CTAAGAGTTTTTAAGGATACAGG - Intergenic
1048152038 8:131903866-131903888 CTTTACGTTTGTGAGGATGATGG - Intergenic
1049089588 8:140504437-140504459 TTTTGATTTTATAAGGATGTTGG + Intergenic
1050617408 9:7416628-7416650 TTTTGAGTTAGTTAGGATCCAGG + Intergenic
1052042222 9:23752021-23752043 CTTGGAGTTTGTCATGATGTGGG - Intronic
1052224656 9:26070924-26070946 CTTTGAATCTGTCAGGATTCTGG - Intergenic
1053368122 9:37538152-37538174 CTTTGAGATTAGAAGGATGGAGG - Intronic
1056746103 9:89304407-89304429 CTAACAGTTTGTAAGGATTCAGG - Intergenic
1059844140 9:118252832-118252854 CTTTGATTTTGTGTGGTTGCTGG + Intergenic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1185815109 X:3147362-3147384 CTGTGAGTTTGCAAGGACACTGG + Intergenic
1187801943 X:23073695-23073717 GTTTGAGTTTTTATAGATGCTGG - Intergenic
1188650012 X:32621020-32621042 CTTGGAGTTTATATGGATGGCGG + Intronic
1190963858 X:55278871-55278893 CTTTGAGCTTGGAAGGTTGTTGG + Intronic
1191663518 X:63674523-63674545 CTAAGAGTTTTTAAGGATTCAGG + Intronic
1192556427 X:72093534-72093556 CTTGGACTTTGGAAGGAAGCAGG - Intergenic
1192628660 X:72757137-72757159 TTTTGAGTTAGTTAGGATCCAGG - Intergenic
1192653048 X:72963677-72963699 TTTTGAGTTAGTTAGGATCCAGG + Intergenic
1194240670 X:91443478-91443500 CTTTGTGTTTGTAAGGAAATTGG + Intergenic
1195134452 X:101890419-101890441 ATTTGAATTTGTAAGAAAGCAGG + Intronic
1196102212 X:111858513-111858535 CTAAGAGTTTTTAAGGATTCAGG + Intronic
1197151448 X:123224324-123224346 CTTAGAGTTTGGAAGGATTTTGG - Intronic
1198404584 X:136300024-136300046 CTAAGAGTTTTTAAGGATTCAGG + Intergenic
1198582434 X:138080391-138080413 TTTTTATATTGTAAGGATGCTGG - Intergenic
1199915520 X:152336006-152336028 CTTTGAAATTGGCAGGATGCTGG - Intronic
1200030860 X:153294002-153294024 ATTTCAGTTTGGAAGGATGAAGG - Intergenic
1200878132 Y:8180987-8181009 CTAAGAGTTTCTAAGGATTCAGG + Intergenic
1201266175 Y:12209345-12209367 CTGTGAGTTTGCAAGGACACTGG - Intergenic
1202034880 Y:20621893-20621915 CTAAGAGTTTTTAAGGATTCAGG - Intergenic