ID: 971130869

View in Genome Browser
Species Human (GRCh38)
Location 4:23808855-23808877
Sequence TTTTGAGTTCCATAAGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971130869_971130871 -2 Left 971130869 4:23808855-23808877 CCTCCTACTTATGGAACTCAAAA 0: 1
1: 0
2: 1
3: 12
4: 136
Right 971130871 4:23808876-23808898 AATAGAAGTAATGCAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971130869 Original CRISPR TTTTGAGTTCCATAAGTAGG AGG (reversed) Intronic
900004991 1:39270-39292 TTGTGTGTTGCATATGTAGGGGG + Intergenic
901251185 1:7781713-7781735 TTTGGAGTTCCCTAAATAGATGG + Intergenic
905873933 1:41420257-41420279 TCTTGAGTTCCGTCAGTAGAAGG + Intergenic
907552122 1:55313329-55313351 CTTTTAGGTCCATAAGCAGGTGG + Intergenic
907596318 1:55723428-55723450 TTTTACTTTCCATGAGTAGGAGG - Intergenic
908120048 1:60977583-60977605 ATTTGCTTTCCATAAGTAGCTGG + Intronic
910524552 1:88163273-88163295 TTCTGAGGTCCTTAAATAGGAGG - Intergenic
911548230 1:99246792-99246814 TTTTCAGGTCAAAAAGTAGGAGG - Intergenic
915479226 1:156173719-156173741 TTTTGTGTTCTCTATGTAGGTGG + Intronic
916292584 1:163182736-163182758 TTTTGAGTTCCAAAGGTGGAGGG + Intronic
917518515 1:175728874-175728896 TCTTCTGTTCCTTAAGTAGGAGG - Intronic
918350279 1:183648206-183648228 TTTTGAGTCCAATAAGTGGTGGG - Exonic
920821065 1:209381427-209381449 TCTTGAGTTCCATAGATAGGTGG - Intergenic
1062898630 10:1124755-1124777 TTTTGAATACCGTAAGCAGGTGG + Intronic
1065340683 10:24701902-24701924 TTCTGAGTTCCCTATGTATGTGG + Intronic
1071414413 10:85427802-85427824 CTTTGGGTTCCATAACTAGACGG - Intergenic
1073583680 10:104689032-104689054 GTGTGAGTGCCCTAAGTAGGTGG - Intronic
1074883281 10:117675095-117675117 TTTTGAAATACATAAGTAGCAGG - Intergenic
1074951079 10:118336929-118336951 TTTTAAGCTACATAAGTAGTTGG + Intronic
1078565796 11:12412912-12412934 TTTTGAATTCTATAAGAAGAGGG + Intronic
1078964076 11:16316711-16316733 GTTTCAGTTCTATAAGTAAGTGG - Intronic
1080191852 11:29560114-29560136 TTTTAAGTTTCATATATAGGAGG + Intergenic
1086564272 11:88207301-88207323 TTGTGAGTTCAATATGTAGTTGG + Intergenic
1087007648 11:93485151-93485173 TTTTAAATTCCATGAGTAGCTGG + Intronic
1087825866 11:102764122-102764144 TTTTGAGCTCCAAAAGGGGGTGG + Intergenic
1087940891 11:104095428-104095450 ATCTGGGTTCCATAAGTAGGAGG + Intronic
1088787882 11:113199234-113199256 TTTTCAGTTGCATATGTAAGTGG - Intronic
1090675543 11:128991256-128991278 TTTTGTGTTCCCTGAGTAGAAGG + Intronic
1091226141 11:133957325-133957347 TGTTGGGTTCCATGAGTGGGCGG - Intergenic
1091378971 12:43448-43470 TTGTGTGTTGCATATGTAGGGGG + Intergenic
1091955890 12:4642365-4642387 TTTTGAGTTCCATAAATTCAGGG - Intronic
1097725220 12:63067447-63067469 TTTTGAATTTCATAATTTGGAGG - Intergenic
1098505525 12:71245738-71245760 TTTTCAGGTCCAAAAGTAGCCGG + Intronic
1099009580 12:77276149-77276171 TTCTGACTTCCATAAGAAGATGG + Intergenic
1106789466 13:33139887-33139909 TATTGAGATTCATAAGTAGGTGG + Intronic
1108503467 13:51088409-51088431 TGTACAGTTCCTTAAGTAGGTGG + Intergenic
1108569791 13:51737955-51737977 TTTTAAGATCAAAAAGTAGGGGG - Intronic
1110787062 13:79541218-79541240 TTCTGAGTTGCATAATTAGAAGG - Intronic
1113819849 13:113205040-113205062 TTATGAGTTCCAAGAGTAGATGG - Intronic
1117229794 14:53705100-53705122 TTTTGAATTAAATAAGAAGGAGG + Intergenic
1117823232 14:59673251-59673273 TTTTGTGTTCCGTGAGTGGGAGG + Intronic
1118334663 14:64842764-64842786 TTTTAAGTGCCACAAGTAGAGGG - Intronic
1118488234 14:66234161-66234183 TTTTCAGTGGCTTAAGTAGGGGG - Intergenic
1120415194 14:84210114-84210136 TTTTGACCTCCTTAAGTAAGAGG - Intergenic
1124500300 15:30222793-30222815 TTTTGAAATCACTAAGTAGGGGG - Intergenic
1124650570 15:31470732-31470754 TTTCGATTGCCATAACTAGGTGG + Intergenic
1124743275 15:32315873-32315895 TTTTGAAATCACTAAGTAGGGGG + Intergenic
1128366861 15:67010473-67010495 TTTTGATTTACATATGTTGGAGG - Intergenic
1131952019 15:97691514-97691536 TCTTGAGTTCCATAAGGAGAAGG - Intergenic
1133800696 16:9082722-9082744 TTTTGATTGCCATAACTTGGGGG - Intergenic
1144721216 17:17471092-17471114 TTCAGAGTTTCATAAGAAGGAGG + Intergenic
1144820044 17:18066292-18066314 TTTTGAGTAGCAAAAGGAGGCGG - Exonic
1151545961 17:74793299-74793321 TTTTGACTGTCATAAGTAGGAGG - Intronic
1156583119 18:38402116-38402138 TTTTGAAATGCATAACTAGGTGG + Intergenic
1158917351 18:62147710-62147732 TTTTGAGGACCATAAGTAAAAGG - Intronic
1160636744 19:80879-80901 TTGTGTGTTGCATATGTAGGGGG + Intergenic
1166358077 19:42239209-42239231 AGTTGAGTTCCAGAAGTAAGAGG - Intronic
929679563 2:43977517-43977539 TTTTGTGCTTCATAAGTAAGAGG - Intronic
930906971 2:56581577-56581599 TGTTTTGTTGCATAAGTAGGTGG - Intergenic
932025530 2:68128332-68128354 TTTTTATTTCCATAAGTTTGGGG + Intronic
932897036 2:75650429-75650451 TTTTGATTTCCCTAAGTTGCTGG - Intronic
936564732 2:113574162-113574184 TTGTGTGTTGCATATGTAGGGGG - Intergenic
940449124 2:153816356-153816378 TTTTGTGTTCCAGAAGTACCAGG + Intergenic
940847846 2:158660815-158660837 TTTTGCGTGCAGTAAGTAGGTGG - Intronic
942306125 2:174609110-174609132 TTGTGAGTGCCATAAGAATGGGG + Intronic
942846957 2:180438349-180438371 TTTTGAGTTCCTTAAACAGCGGG - Intergenic
943163569 2:184286180-184286202 TTTAGAGGTTCATAACTAGGTGG + Intergenic
943225439 2:185168158-185168180 TTTTGAATTCCATAAGAACAGGG + Intergenic
944525824 2:200618670-200618692 TTTTGAGGCCCTTAAGTAGTTGG + Intronic
948202619 2:236140778-236140800 TTTTGATTTCCAGATGTTGGAGG + Intergenic
1169973409 20:11296170-11296192 CTCTGATTTCCTTAAGTAGGAGG + Intergenic
1172018818 20:31898099-31898121 TTTTCAGTTGTATCAGTAGGAGG + Intronic
1173328257 20:42052881-42052903 TTATGAGTTCTACAAGTAGCTGG - Intergenic
1182458845 22:30470226-30470248 TTTTGACTTGCAGAAGTCGGAGG - Exonic
949143667 3:668045-668067 TTTTGAGTTCAGTAATTAAGAGG + Intergenic
954117646 3:48476030-48476052 TTTTGAGTTCCCTAGGCATGAGG - Intronic
955824470 3:62930626-62930648 CTTTGAGTTCCATAAAAATGAGG - Intergenic
955858042 3:63295862-63295884 TTTGCAGTTTCATAAGTAGATGG - Intronic
958177867 3:90019668-90019690 TTTTGAGTTTTATAAGTAGTTGG + Intergenic
959161247 3:102727051-102727073 TTATGAGTTACATAAGAAGGTGG - Intergenic
960221386 3:115113460-115113482 TTTTCAGTGCCAAAAGCAGGAGG - Intronic
964726000 3:159815001-159815023 TTCTGAGTTCCTTAAGGAGGGGG + Intronic
966929453 3:184666338-184666360 TTTTGAGTCCCAGAAGCAAGAGG - Intronic
970027831 4:11642386-11642408 TTTTAAGTACTAAAAGTAGGAGG + Intergenic
970622998 4:17846053-17846075 TATTTAGTTCAGTAAGTAGGCGG - Intronic
970825615 4:20269816-20269838 TTATCAATTCCAGAAGTAGGAGG + Intronic
970843716 4:20509735-20509757 TTGTGCGTTTCATAACTAGGTGG + Intronic
971130869 4:23808855-23808877 TTTTGAGTTCCATAAGTAGGAGG - Intronic
971548986 4:27925191-27925213 TCATGAGTTTCAAAAGTAGGAGG + Intergenic
971797175 4:31242981-31243003 TATTGAATTCCATAATCAGGAGG + Intergenic
972569954 4:40301479-40301501 TTTTGAGTCCCATAAGAAGGTGG - Intergenic
974276843 4:59731500-59731522 TTTTTAGTTCCATAAGTTATTGG - Intergenic
976839170 4:89411128-89411150 GTTTGAGCTCCATATATAGGAGG + Intergenic
976969240 4:91083887-91083909 ATTTGAGTTCCAGAATTAGATGG + Intronic
977853429 4:101858237-101858259 TTTTGATTGTCATAACTAGGGGG + Intronic
978490461 4:109306237-109306259 TTTTGAGTTGCATTAATGGGAGG - Intergenic
985371998 4:189295448-189295470 TGTTGAATTACATAAGGAGGCGG + Intergenic
987656930 5:20819286-20819308 TTTTGAGTGCCATGATTAGATGG + Intergenic
988766623 5:34384662-34384684 TTTTGAGTGCCATGATTAGATGG - Intergenic
991982978 5:72252636-72252658 TGTTGAGCACCAGAAGTAGGTGG + Intronic
993574869 5:89588314-89588336 AATTGATTTCCATAACTAGGTGG + Intergenic
994694831 5:103061137-103061159 TTTTGACTTACATAACTAGAAGG - Intergenic
996947979 5:129093581-129093603 TTTTGATTGCCATAACTAGAGGG + Intergenic
999084914 5:148879472-148879494 TTTTGAATTCCATAAGAAAAGGG - Intergenic
999122000 5:149216944-149216966 TTTTCATTTCCATAGGCAGGAGG + Exonic
1000475272 5:161699304-161699326 TTTAGTGTTCCATATGTGGGAGG + Intronic
1002688694 5:181035915-181035937 GTTTGAGTTGCATAAACAGGTGG - Intergenic
1003538961 6:7001578-7001600 TGTTGAATTCAATAAGCAGGAGG - Intergenic
1004648221 6:17583390-17583412 TTTTGAGTGCAAGAAGAAGGGGG + Intergenic
1009644105 6:66374844-66374866 TTTTGAGTTCCAGGAGTAAAGGG - Intergenic
1011433475 6:87313275-87313297 TCTTAAGTTCAATAAGTAGTAGG - Intronic
1011630364 6:89317227-89317249 TTGTGAGATCCCTAGGTAGGGGG + Intergenic
1011921844 6:92587508-92587530 TTTAGAGTTGAATATGTAGGTGG + Intergenic
1012796053 6:103762998-103763020 TTTTGAATTCCAAAAGTGTGAGG - Intergenic
1014076348 6:117239540-117239562 TTTTAAGCTCCATAGGAAGGAGG - Intergenic
1020867266 7:13582425-13582447 TTTTCAGTTTCAAAAGTAGAAGG + Intergenic
1022591201 7:31664942-31664964 TTTGGAGATTCTTAAGTAGGTGG - Intergenic
1024346646 7:48321155-48321177 TTTTTAGTGTCACAAGTAGGAGG + Intronic
1028265323 7:88716833-88716855 TTTTAAGTTCCATATATAGGGGG + Intergenic
1029056790 7:97753523-97753545 TTTAGAGATACATAAGTAAGTGG + Intergenic
1029164358 7:98576570-98576592 GTTTGCCTACCATAAGTAGGAGG - Intergenic
1031375999 7:121026559-121026581 TTTTAAGTTCCTTAAGTAATTGG - Intronic
1034764393 7:153704463-153704485 TTTTGAGTTACAGAATTAGGTGG + Intergenic
1040370697 8:46770054-46770076 TTTAGAGATACATAAGTAAGTGG - Intergenic
1041488590 8:58407139-58407161 TTTTGAGTTCAAAATGTATGTGG - Intergenic
1042023299 8:64394546-64394568 TTTTGAATTCCACTATTAGGAGG - Intergenic
1045377432 8:101588617-101588639 TTTTGAGTTGCTTAAGTAATTGG + Intronic
1045746287 8:105426129-105426151 CTTTGAGTTCAATAAGGAAGGGG + Intronic
1046985594 8:120384472-120384494 TTTTGAGTTCCAAAAATAACAGG + Intronic
1047731153 8:127729547-127729569 TTTTGATTTCCATAAATCAGTGG - Intergenic
1050269653 9:3928949-3928971 TTGTAAGTGCCATAAGCAGGAGG - Intronic
1050507166 9:6360405-6360427 TTCTAATTTCCATTAGTAGGAGG - Intergenic
1050998562 9:12251100-12251122 TTTTGTTTTTCATAAATAGGTGG + Intergenic
1051396172 9:16623789-16623811 TTTTGAGATCTATCAGTAGCAGG + Intronic
1051689495 9:19695110-19695132 TTTTGATTTCCATAACTGGAGGG + Intronic
1052107458 9:24536765-24536787 TTTTCATTTCCATAAGTTTGGGG - Intergenic
1053182841 9:35988802-35988824 TTTTGATTTCCATATGTAGCAGG - Intergenic
1055777907 9:79785961-79785983 TTTTAAGATCTATATGTAGGGGG + Intergenic
1057236610 9:93366345-93366367 TTTTGAGCCCCATCACTAGGCGG - Intergenic
1058147768 9:101430610-101430632 TTTTGAGTCCTGTAAGTAGTAGG - Intronic
1059633657 9:116152590-116152612 TTTTGAGTTCTATAAAGAGGGGG + Intergenic
1060000578 9:119954715-119954737 TTTTAAGTTCCTTAAAGAGGGGG + Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1186663407 X:11692929-11692951 TTTTTATTTCCAAAAGTGGGAGG + Intergenic
1187406934 X:19012842-19012864 GTTTCAGTTCCATGAGTAAGAGG - Intronic
1187591972 X:20726586-20726608 TTTTCAATTACATAGGTAGGAGG + Intergenic
1188012538 X:25073206-25073228 CTTTAACTTCCATAAGTTGGGGG + Intergenic
1190517342 X:51237288-51237310 TTTAGAGTTCCAGAAGGAGAAGG + Intergenic
1199212404 X:145228701-145228723 TTTTGAGTTTCTTCAGCAGGAGG - Intergenic
1201906178 Y:19087556-19087578 ATTGGAGTTCAAAAAGTAGGTGG - Intergenic