ID: 971131201

View in Genome Browser
Species Human (GRCh38)
Location 4:23812956-23812978
Sequence GAGAACATCTTGTCATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971131201 Original CRISPR GAGAACATCTTGTCATCTCA AGG Intronic
903680135 1:25090958-25090980 GAGAGCATCGTGACAGCTCAGGG + Intergenic
911287175 1:96009999-96010021 CAGACCATCCTGTCACCTCAGGG - Intergenic
911790392 1:102008048-102008070 GAGAACATCTAGCCATCTATTGG + Intergenic
912593799 1:110853776-110853798 GAGATCATCTTTTCATTTCAAGG - Intergenic
918029294 1:180788760-180788782 GAGAATATATTCTCATCTCTTGG + Intronic
918266635 1:182848252-182848274 GAGACCATTTTGTCCCCTCAAGG + Intronic
920629682 1:207639376-207639398 GAAAACATCCTGTTATTTCAGGG + Exonic
924632122 1:245750979-245751001 GAGAACATGTTGGAATCTCCTGG - Intronic
924872070 1:248058461-248058483 GACAACATCATTTCATCTTATGG + Intronic
1064037318 10:11925144-11925166 AAGAACATCTGGTCCTCTAAAGG + Intronic
1070588960 10:77787984-77788006 GAGAACATAATGTGATCTCAAGG - Intergenic
1074692650 10:116020333-116020355 GAGAACAACTCCTCTTCTCAAGG - Intergenic
1076247287 10:128957378-128957400 GAAATCCTCTTGTCACCTCAAGG - Intergenic
1078159440 11:8828125-8828147 GAGAACCTCTTGAGTTCTCAAGG + Intronic
1078862175 11:15259024-15259046 AAGAAAATCTTGTCAGCTCCTGG + Intergenic
1080069904 11:28070074-28070096 CAGAACATCTTGACGTCTCTGGG + Intronic
1081314672 11:41617159-41617181 GAGAGCATCTCAGCATCTCAGGG - Intergenic
1086211108 11:84320070-84320092 CAGAATTTCATGTCATCTCATGG - Intronic
1086368965 11:86137407-86137429 CTGTCCATCTTGTCATCTCAAGG - Intergenic
1087173881 11:95078347-95078369 GAGCACATGTTGCTATCTCAGGG - Intergenic
1088607331 11:111544096-111544118 GAAAACCTCTTGCCATCTGATGG + Exonic
1091023124 11:132119031-132119053 GAGAACATCTTTTCATCCGCTGG - Intronic
1091854384 12:3727591-3727613 GAGATCATCTCGTCATTTCGAGG + Intronic
1094336004 12:29354647-29354669 GTTCATATCTTGTCATCTCAGGG - Intronic
1095537291 12:43265788-43265810 AAGAACATCTTTTGATCTTAGGG + Intergenic
1096453219 12:51763059-51763081 GAGAAATTCTTGCCATTTCAAGG - Intronic
1097798451 12:63887665-63887687 GACAAAACCTTTTCATCTCAAGG - Intronic
1099164744 12:79290323-79290345 TAGAAAATCTTGTAATTTCAAGG + Intronic
1099737209 12:86585581-86585603 GAGAACTTCAAGTCATCACATGG - Intronic
1100739768 12:97579152-97579174 GAGAAGATTTTCTCATCACATGG + Intergenic
1104311987 12:127661646-127661668 GAGAACATCTTGTCACATCCAGG - Intergenic
1108991662 13:56666261-56666283 GAGAACAGCTTGTTAGCTGAGGG + Intergenic
1109265085 13:60188936-60188958 GAAAACATTTTGAAATCTCAGGG - Intergenic
1110052577 13:70923178-70923200 GAAAGCATCTTGTCATTTGATGG + Intergenic
1111837816 13:93410855-93410877 GAGAATGTCTTTTCTTCTCAGGG + Intronic
1114815946 14:25958287-25958309 GTAAACATCTTCTCATCTGAGGG - Intergenic
1115920951 14:38372712-38372734 GTGTACCTCTTGTCCTCTCAGGG - Intergenic
1117611023 14:57483697-57483719 GAGATCATGTTGGCATTTCAGGG + Intronic
1118348330 14:64955827-64955849 GAGAATATCTCTTCTTCTCACGG - Intronic
1121988798 14:98534166-98534188 AGGATCATCTTCTCATCTCAAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1130886268 15:88095138-88095160 GAGAACAGCTTGTGTTCTCTAGG + Intronic
1138326434 16:56174881-56174903 AAGATAATCTTTTCATCTCAAGG + Intergenic
1140160896 16:72492723-72492745 GAGAACACCTCTTCATTTCAGGG - Intergenic
1143250198 17:5517841-5517863 GAGAACAGCTGGTCTTCTCCAGG + Exonic
1144856166 17:18269207-18269229 GAGACCAGCTTGTAATCCCAGGG - Intergenic
1149155542 17:53624900-53624922 GAGACCCTCTTGCCATCTCTGGG + Intergenic
1149208092 17:54272227-54272249 GACAACATCTGCTAATCTCAGGG + Intergenic
1151238033 17:72735810-72735832 GAGAACAGCATGTGATCCCAAGG + Intronic
1151414847 17:73955382-73955404 GACAACATCTTGTTCTATCATGG - Intergenic
1203173744 17_GL000205v2_random:175674-175696 GACAACATAATGTCACCTCAGGG - Intergenic
1153929123 18:9863194-9863216 GATAACATTTGGTCATTTCAAGG + Intergenic
1155766066 18:29634622-29634644 GAGACCATCTTTGTATCTCAAGG + Intergenic
1158924612 18:62241622-62241644 TAGAACACCTTGTCTTCTGATGG + Intronic
1160627952 18:80225870-80225892 GAGCACACCTAGTCATCTCTGGG + Intronic
1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG + Intronic
925830931 2:7894992-7895014 GAGATCATCTTTTATTCTCATGG + Intergenic
926257743 2:11223121-11223143 GATAACATCTCCTCATCTCCAGG + Intronic
927341346 2:21986807-21986829 GAGAACAGCTACTCATCTCAGGG + Intergenic
933165881 2:79074131-79074153 GAGAAGATCTTTTCATGTGAGGG - Intergenic
933653270 2:84866021-84866043 GATTTGATCTTGTCATCTCAGGG - Intronic
936944757 2:117920445-117920467 GAGACCATCTTGGCCTCACATGG - Intronic
939356390 2:141108789-141108811 AAGGACATCTTGTCAGGTCATGG - Intronic
944526462 2:200624752-200624774 GAGAACATCCTATCATTTCATGG - Intronic
946828154 2:223700317-223700339 GAGAGCATGTTATCATCTCATGG - Intergenic
1169777572 20:9272749-9272771 AAGAACATCTTTTCATTTTAAGG - Intronic
1169830408 20:9819109-9819131 GAGGACATATTGTCATTACAAGG - Intronic
1173567526 20:44052315-44052337 GAGAACATCTTGTCTTACCAGGG + Intronic
1175369167 20:58475650-58475672 GAGAGCATCTGGGCATCTCAGGG + Intronic
1177650815 21:23960135-23960157 AAGCACATCTTGTCCTCTCTTGG - Intergenic
1179263228 21:39777250-39777272 GAGAGCATCCTGTCATGTCGTGG + Intronic
1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG + Intergenic
1183541520 22:38431831-38431853 GAGAAAATCTGGCCATCTCCTGG - Intronic
1184328324 22:43809251-43809273 GGGAGCTTCTTGTCAACTCATGG - Intronic
950931551 3:16793699-16793721 GAGAGCATATAGTCATCTGACGG - Intergenic
954502735 3:51035541-51035563 TCCAACATCTTATCATCTCAGGG + Intronic
955375744 3:58395326-58395348 GAGAACAGCTTGCCATGTAATGG - Intronic
956487337 3:69737002-69737024 GAGGACTTCTAGTCATCTCAAGG + Intergenic
957179063 3:76852497-76852519 GAGATCATGATGTCATCTCAAGG + Intronic
958577303 3:95967569-95967591 TAAAACATATAGTCATCTCACGG - Intergenic
960092378 3:113654637-113654659 GAGATCATCTTGTCATGTACTGG - Exonic
960092736 3:113658033-113658055 GAGAACAACTTGGTTTCTCAAGG + Exonic
967050404 3:185778184-185778206 GAGCACGTCTTGGCAGCTCAGGG + Intronic
967416040 3:189219594-189219616 GAGAACATCTTGACACTTTATGG + Intronic
967810810 3:193759397-193759419 GATGACATCTTGTCTTCTCTTGG + Intergenic
971040088 4:22742235-22742257 GAGAAAATCTTTGCTTCTCAGGG - Intergenic
971131201 4:23812956-23812978 GAGAACATCTTGTCATCTCAAGG + Intronic
972786687 4:42332817-42332839 GAGAACATCTCAGCATCTCTAGG - Intergenic
976441122 4:85075997-85076019 GAGCCCATCTTGACAGCTCAGGG + Intergenic
976877214 4:89867774-89867796 GAGAACATCATGACATCCGAAGG + Intergenic
978258120 4:106717633-106717655 GATAACTTGTTGTCAACTCAAGG + Intergenic
978337155 4:107681600-107681622 GAGATCATCATGTTATCACAAGG + Intronic
982617503 4:157658853-157658875 TAGAACACCTTGTCCTCACATGG + Intergenic
984333095 4:178352218-178352240 ATGTACATCTTGTCAGCTCATGG + Intergenic
986821236 5:11469059-11469081 CAGAGCAACTTGCCATCTCAGGG - Intronic
988446824 5:31295976-31295998 GAGAACATCTTATGATTTTAGGG - Intronic
991283657 5:64944471-64944493 GAAAACATCTTTAAATCTCATGG + Intronic
991404088 5:66284805-66284827 CAGATCACCTTGTCATCCCAGGG - Intergenic
991420679 5:66438218-66438240 GAGTCTATCTTGGCATCTCAGGG + Intergenic
993506773 5:88718395-88718417 TATAACATCTTGTCATCTAGTGG + Exonic
995158468 5:108944840-108944862 GAAAACATCTTTTCATATGAAGG - Intronic
995300804 5:110579103-110579125 AAAAACAACTTGTCATGTCAAGG + Intronic
995703174 5:114958240-114958262 GAGAAAATCTTAGCATCTCCTGG - Intergenic
996395846 5:123013047-123013069 GAGAACATCTGTTCAACTCTTGG + Intronic
998628988 5:143877742-143877764 CAGACCAACTTGTCATTTCAAGG - Intergenic
1001050966 5:168414213-168414235 TTGATCAGCTTGTCATCTCAAGG - Intronic
1004415773 6:15422914-15422936 GAGTCCATCTTGTCTTCTCATGG + Intronic
1009188506 6:60601593-60601615 GAGACCAGCTTGTAGTCTCATGG - Intergenic
1011554217 6:88557693-88557715 AAGAACATAATGTCACCTCATGG + Intergenic
1012985267 6:105868744-105868766 GAGAACTTCTCGAGATCTCAGGG - Intergenic
1015405084 6:132827684-132827706 AATAACATCTTGTTATCTTAGGG + Intergenic
1017125303 6:151059127-151059149 GAGAACATCATCCCACCTCAGGG - Intronic
1018927458 6:168216345-168216367 GGGAACCTCTTGTCGGCTCAGGG + Intergenic
1019126926 6:169846677-169846699 GAGCACATCATGTCCTCTCCGGG - Intergenic
1020632625 7:10657639-10657661 GTGAACTTCTTGTCATTTTAGGG + Intergenic
1021876904 7:25058112-25058134 CAGAAAATCTTTCCATCTCAAGG + Intergenic
1026422370 7:70253641-70253663 GAGACCATCTTATATTCTCAGGG + Intronic
1027975057 7:85142889-85142911 GAGAAAGTCTTTTCAACTCATGG - Intronic
1028486272 7:91361000-91361022 GATAATATTTTGTCATCTCGTGG - Intergenic
1030912784 7:115273485-115273507 GAGAAATTGTTGTCATCTAAGGG + Intergenic
1033396370 7:140977787-140977809 AAGAATATCTTTTCATCTAAAGG + Intergenic
1034396788 7:150832189-150832211 GAGAACATTTAGCAATCTCAAGG - Intronic
1036028347 8:4936451-4936473 CAGAACATCTTATTATTTCAAGG + Intronic
1037119273 8:15263763-15263785 GAGAACATCTTTACTTCTCCCGG - Intergenic
1039485839 8:37909130-37909152 GAGATGATCGTGTCATATCAAGG - Intergenic
1041558267 8:59184314-59184336 GACAACATCTTGTTCTGTCATGG + Intergenic
1042349693 8:67764487-67764509 GAGAGCCTCTTGTTATCTGAGGG + Intergenic
1044170813 8:89049806-89049828 AATAAGATCTTGTCATGTCAAGG - Intergenic
1045392521 8:101729708-101729730 GAAATCATCTTGTCTTCTCCAGG + Intronic
1045767196 8:105687369-105687391 AAGAGAATCTTGTCATCTCAGGG + Intronic
1045889366 8:107136167-107136189 CAGACCATATTTTCATCTCATGG - Intergenic
1046203699 8:110960216-110960238 GAACACATGTTGTCATCTCTTGG - Intergenic
1051986960 9:23101159-23101181 AAGAACATTATGTCATCACATGG - Intergenic
1052340338 9:27358858-27358880 GTGGACATCTTGGCATCTCCTGG + Intronic
1053616151 9:39768590-39768612 GAGAACATATTGTGATCTTGAGG + Intergenic
1053874322 9:42527896-42527918 GAGAACATATTGTGATCTTGAGG + Intergenic
1053898293 9:42766692-42766714 GAGAACATATTGTGATCTTGAGG - Intergenic
1054237366 9:62573800-62573822 GAGAACATATTGTGATCTTGAGG - Intergenic
1054268013 9:62938858-62938880 GAGAACATATTGTGATCTTGAGG - Intergenic
1054551501 9:66608311-66608333 GAGAACATATTGTGATCTTGAGG - Intergenic
1055661731 9:78510795-78510817 TAGAGCATCTTTTCATTTCATGG + Intergenic
1055699351 9:78925810-78925832 GAGAACATATTCAGATCTCATGG - Intergenic
1056691758 9:88813844-88813866 GTTAACATCTTTTCATCTCTGGG + Intergenic
1058170431 9:101674052-101674074 GAAATGATGTTGTCATCTCAAGG + Intronic
1058758849 9:108110011-108110033 GAGAGCATCTTTTTATCTCTAGG + Intergenic
1059756188 9:117295914-117295936 GAGATCAGCTGGTCATCGCAGGG + Intronic
1186162385 X:6791494-6791516 AAGATAATCTTTTCATCTCAAGG - Intergenic
1186342160 X:8656785-8656807 GGGAACATATGGTCATCTGAGGG - Intronic
1187119725 X:16392571-16392593 GAGACCATCTTGACACCTGATGG - Intergenic
1187945895 X:24426245-24426267 AAGAACATCTTGTCTCCCCAGGG + Intergenic
1189586933 X:42471472-42471494 GAGAACATCCTGGCATTTGAGGG + Intergenic
1189929344 X:45991424-45991446 GAGTTCATCTTGCTATCTCAGGG + Intergenic
1190714319 X:53091126-53091148 AAGAACATCCTGTCCTCACATGG - Intergenic
1192345739 X:70303810-70303832 TAGAACATTTTATCATCCCAAGG + Intronic
1194696903 X:97063811-97063833 TTGAACATCTTGTTATGTCAGGG + Intronic
1196472592 X:116045662-116045684 GAGAATATTTTGTCATATTATGG - Intergenic
1196870774 X:120111172-120111194 GAGAACATTATGTCGACTCAGGG + Intronic