ID: 971132525

View in Genome Browser
Species Human (GRCh38)
Location 4:23828478-23828500
Sequence CTGTGGGTTTGGTGTGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 572}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971132525 Original CRISPR CTGTGGGTTTGGTGTGAGGA GGG Exonic
900154054 1:1197049-1197071 CAGTGGGCTCGGGGTGAGGAGGG + Intronic
900374228 1:2346129-2346151 CTGGTGGCTTTGTGTGAGGAAGG - Intronic
900377940 1:2367574-2367596 CTTTTTGTTTGGTGTAAGGAAGG - Intronic
900389860 1:2429123-2429145 CTGGGGATTGGGTGCGAGGAGGG + Intronic
900636797 1:3669837-3669859 GTGGGGATTTGCTGTGAGGAGGG + Intronic
901277812 1:8006299-8006321 GTGGGGTTTTGGTGTGGGGAGGG - Intronic
901420106 1:9145056-9145078 CCCTGGGTTTGGTGAGAGGGAGG + Intergenic
901745962 1:11373634-11373656 GTGTGTGTGTGGTGTGTGGATGG + Intergenic
901868577 1:12123918-12123940 TTGTGGGTATGGTCTGAGAAGGG + Intronic
902299797 1:15493804-15493826 CTGGGGATTTGGGGTGAGCAGGG - Intronic
902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG + Intronic
902801136 1:18830995-18831017 GTGTGGGGTGGGTGAGAGGAGGG - Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903830380 1:26170804-26170826 CTCTGGGTTTGGGGAGCGGAGGG + Exonic
903884805 1:26534997-26535019 ATGAGGGTTTGGAGTGGGGAAGG + Intronic
904391333 1:30188254-30188276 CTGTGGGAATGGTGTGACGCTGG - Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
906324272 1:44834554-44834576 AAGTGGGTTTGCTGAGAGGAAGG + Intronic
906409856 1:45569705-45569727 CTATGGGTTTGGTGCTAGAATGG + Intronic
906461615 1:46038956-46038978 TTGTAGGTTTGGTGGTAGGAAGG + Intergenic
906577520 1:46904126-46904148 CAGTGGGCTTGGTGTTAGGTAGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907543138 1:55234735-55234757 CTGTGGGTTTGGTTTTAGTCTGG + Intergenic
907752133 1:57272821-57272843 CAGTGGGTTGGGTGTGGGGCGGG + Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
908756857 1:67476898-67476920 CTTTGTGTATGGTGTGAGAAAGG - Intergenic
909115071 1:71523174-71523196 TTGTTGGGTTGTTGTGAGGATGG + Intronic
909193515 1:72586424-72586446 CTGTGGATTTGGTGACAGAAAGG + Intergenic
911032410 1:93503593-93503615 TTTTGGTTTTGGTTTGAGGATGG + Intronic
911707808 1:101035127-101035149 CTTTTTGTTTGGTGTCAGGAGGG - Intergenic
911896827 1:103446565-103446587 CTGTTGGTTGGGTCTGGGGAGGG + Intergenic
912519757 1:110237338-110237360 CTGTTGATTTGGTATGGGGATGG - Intronic
912954883 1:114148401-114148423 CTCTGGCTTTGGGGTGAGTAGGG - Intronic
913265512 1:117039292-117039314 AGGTGGGGTTGGAGTGAGGATGG + Intergenic
913274184 1:117121750-117121772 GGCTGGGATTGGTGTGAGGAGGG - Intronic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
914860772 1:151384067-151384089 CTATGTGTTTGCTGTGAAGATGG - Intergenic
915118388 1:153614091-153614113 CTATGGGTTTGGGTTGAGGGTGG - Intergenic
916303521 1:163302781-163302803 TTCTGAATTTGGTGTGAGGAAGG - Intronic
917588735 1:176455428-176455450 TTGTGAGTTTGGAGTGAGGAAGG + Intergenic
917639594 1:176970066-176970088 CTGTGGGTATTGTGTGAGACAGG - Intronic
918234483 1:182566278-182566300 TTTTGTGTATGGTGTGAGGAGGG + Intergenic
918647769 1:186922146-186922168 ATGTGTGTGTGGTGTGAGCATGG - Intronic
918803669 1:189009039-189009061 ATGTGGTTTTAATGTGAGGATGG - Intergenic
919452248 1:197786372-197786394 GTGTGGGTATGGGGTGAGAAAGG + Intergenic
920997850 1:211012311-211012333 CTGTGGGTTTGATTGGAGGGTGG - Intronic
921049982 1:211504366-211504388 CTGGGGGTTTGGTGGGTGGTGGG - Intergenic
921347805 1:214205020-214205042 CTGTGTGTTTGTTGTGATGGAGG + Intergenic
922431280 1:225556851-225556873 CTGTGCCTATGGTGTGAGGTAGG + Intronic
922696742 1:227734856-227734878 CAGACGGTTTGGAGTGAGGACGG - Intronic
922741928 1:228018959-228018981 TTGTGGATTTGGGGTCAGGATGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923660535 1:235953197-235953219 CTGTGGTTTTGGGGTAAGGTGGG - Intergenic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1062811866 10:472627-472649 CTCTGGCTTTGCTGTGGGGATGG - Intronic
1062922600 10:1291488-1291510 TGGTGGTTTTGCTGTGAGGAGGG - Intronic
1063589100 10:7378594-7378616 CTGTGGGGTGGGTGTGAGTGTGG + Intronic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1065018057 10:21479601-21479623 ATGTGGCTTTGGTTTCAGGAGGG + Intergenic
1065513227 10:26500311-26500333 CTGTGACTTTGGGGTGAAGACGG - Intronic
1065864139 10:29898858-29898880 TTATGGCTTCGGTGTGAGGAAGG + Intergenic
1066504562 10:36027844-36027866 GGGTGGTTTTGGTGTCAGGATGG + Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067088051 10:43253171-43253193 GTGTGGGGTGGGTGTCAGGAAGG - Intronic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067421471 10:46154510-46154532 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067506808 10:46860961-46860983 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067564326 10:47325912-47325934 CTTTGGGTGGGGTGTGGGGAGGG - Exonic
1068799260 10:61121014-61121036 CTGTGGTTTTGGTTTCAGGAAGG + Intergenic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1069752005 10:70750819-70750841 ATTTGTGTATGGTGTGAGGAAGG - Intronic
1069776090 10:70928098-70928120 CTGGGGGTTTAGAGAGAGGAGGG + Intergenic
1070601403 10:77868835-77868857 CTTTGGGGTTGGGGTGGGGATGG + Intronic
1072456848 10:95583924-95583946 CTGTGGGACTGGTGAAAGGATGG + Intergenic
1072631463 10:97149720-97149742 ATGTGGGTTTGGGGTCAGGTGGG + Intronic
1072719193 10:97770537-97770559 CTGAGGGGTGGGTGGGAGGAGGG + Intronic
1072921794 10:99583027-99583049 AGTTGGGTTTGGTGGGAGGAGGG + Intergenic
1073160183 10:101386945-101386967 TTTTGGGTTTGATGTGACGAAGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073866682 10:107812674-107812696 ATGTGGGTGTGGTGAGGGGAAGG + Intergenic
1074406894 10:113187604-113187626 CTGTGGGGCTGCTGTCAGGAAGG - Intergenic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1075362849 10:121854946-121854968 CTGTGGGTTTGTTTTGGGTAAGG - Intronic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075455994 10:122585421-122585443 CTGTGGGTTGCATGGGAGGAAGG + Intronic
1075457307 10:122593155-122593177 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458121 10:122598124-122598146 CTGTGGGTTGCATGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458889 10:122602685-122602707 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459520 10:122606744-122606766 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460152 10:122610803-122610825 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460784 10:122614862-122614884 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075539821 10:123302754-123302776 TTTTGGGTATGGTGTGAGGTAGG - Intergenic
1075926190 10:126253684-126253706 TTGTGGGTTGGGTGGGGGGAGGG + Intronic
1076097015 10:127739983-127740005 GTGTGGGTGTGGTGTGAGTGTGG - Exonic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076622378 10:131799848-131799870 CTGTGGCTTGATTGTGAGGAGGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076808773 10:132875692-132875714 ATGTGTGTGTGGTGTGAGGTAGG - Intronic
1076928668 10:133511062-133511084 GTGTGGGATTGGTGCAAGGAGGG + Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077703530 11:4462840-4462862 TTGTGGGTTTGGTGAGAGGGTGG - Intergenic
1077898963 11:6474555-6474577 CAGTGTCTTTGGTGTGAGGAAGG - Intergenic
1078023322 11:7672966-7672988 CTGTGCCTTTGGTGTGGGGAGGG - Intronic
1078352844 11:10608988-10609010 TTGTGTGTTTTGTGTGAGGTAGG + Intronic
1078469416 11:11575202-11575224 CTGTGGGTGGGGTGTGGGGCTGG + Intronic
1079460817 11:20676347-20676369 CTGTGGGTTAGGTTGGGGGAGGG - Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1081279285 11:41188146-41188168 TTGTGTGTTGGGTGGGAGGAGGG - Intronic
1083205355 11:61145513-61145535 CTGTGGCATTGGTGAGAGAAAGG - Intronic
1083663980 11:64265008-64265030 CTGGGGGTGGGGTTTGAGGACGG - Exonic
1083994530 11:66265585-66265607 CTGTGGGCTGGGTGCCAGGATGG + Intronic
1084207716 11:67605625-67605647 CTGTGGGTTTGCTGTGTGCGGGG + Intronic
1084661538 11:70549342-70549364 CTGTGGGCTTGGGGTGAGAGAGG - Intronic
1085485694 11:76861078-76861100 CTGTGAGTGTGGCCTGAGGAGGG + Exonic
1086338545 11:85824319-85824341 CTGTTGGGTGTGTGTGAGGAGGG + Intergenic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089352425 11:117829072-117829094 CTGTGGCTTTGCTGTGGGCAAGG - Intronic
1089369684 11:117946632-117946654 CTGTGGGTTTGGGCTGAGCCAGG + Intergenic
1090114629 11:123955489-123955511 CAGGGGGTTGGGTGGGAGGAAGG + Intergenic
1090351228 11:126109916-126109938 ATGTGGGTTTGGCCTGAGGTGGG - Intergenic
1091693371 12:2611779-2611801 CTGGGGGTTTGGTTCAAGGAAGG + Intronic
1091808032 12:3370009-3370031 TTGTGGCTTTGTTTTGAGGATGG + Intergenic
1092125843 12:6074555-6074577 CTGTGGTGGGGGTGTGAGGAAGG - Intronic
1093165979 12:15804735-15804757 CTGTGGGGTTGTTGAGGGGAAGG - Intronic
1094640960 12:32275334-32275356 CAGTGGTTTGGGAGTGAGGATGG + Intronic
1095881313 12:47139921-47139943 ATGTGTGTTTCGTGTGAGTAGGG + Intronic
1095904381 12:47362497-47362519 CTGTGGGTCTGATGTGAGTCAGG + Intergenic
1095939852 12:47718884-47718906 CTGTTTGTTGGGTGTGTGGAGGG - Intronic
1096207501 12:49735201-49735223 GTGTGCGTGTGGTGTGAGCATGG + Intronic
1096487792 12:51995257-51995279 TGGTGGGTTTGGGGTGGGGAAGG + Intronic
1096806800 12:54145852-54145874 CAGTTGGTTTGGTGTGGAGAAGG - Intergenic
1096842736 12:54389443-54389465 CTGTGGGCTTGGCATAAGGAGGG + Intronic
1097119542 12:56720821-56720843 TTGTGGGTGTTGTCTGAGGAAGG + Exonic
1097508679 12:60507947-60507969 CTGTGGGCATGGTGTGATGGAGG + Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098957944 12:76706841-76706863 CTGTAGTTTTGGGGAGAGGAAGG + Intergenic
1099012637 12:77309949-77309971 CTGAGGTATTGGTTTGAGGAGGG + Intergenic
1099257651 12:80334083-80334105 TTGTGGGTAAGGTGTAAGGAGGG + Intronic
1099446098 12:82753414-82753436 CTGTGGTTTTACTGTGTGGAGGG + Intronic
1100357441 12:93844695-93844717 CTGTTGGTTGGGTGTTGGGAAGG - Intronic
1100400825 12:94227581-94227603 CTGGGGGTTATGTGTGTGGATGG + Intronic
1100892187 12:99137921-99137943 CTGTGAGCTTTGTGAGAGGAGGG + Intronic
1100917293 12:99439148-99439170 CTTTGTGTATGGTGTGAGGTGGG - Intronic
1101766176 12:107701606-107701628 TTGTGTGTATGGTGTGAGGTAGG + Intronic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102033370 12:109757497-109757519 TTTTGGGTATGGTGTGAGGTAGG - Intronic
1102559208 12:113750027-113750049 CTCTGGGCTTGGTGTGGGCAGGG + Intergenic
1104215811 12:126732290-126732312 AGGTGTGTTTGGGGTGAGGATGG - Intergenic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104647342 12:130506587-130506609 TTGTGAGGTCGGTGTGAGGAAGG - Intronic
1104924856 12:132308815-132308837 CCGTGGGTGAGGTGTGAGGACGG - Intronic
1104996806 12:132663319-132663341 GTGTGGGTGTGTTGTGGGGACGG - Intronic
1105333843 13:19444951-19444973 TTATGTGTGTGGTGTGAGGAAGG - Intronic
1106606041 13:31230224-31230246 CTGGAGGTTTGGAGTGAGGGAGG + Intronic
1107487988 13:40849474-40849496 TTATGTGTGTGGTGTGAGGAAGG - Intergenic
1107613552 13:42141046-42141068 TTGTGGGGTTGGTGGGAGGGGGG - Intronic
1109629940 13:65033027-65033049 GTGTGGGTGTGGTCTGAGGTGGG + Intergenic
1110069405 13:71154634-71154656 CTTTGTGTATGGTGTTAGGAAGG + Intergenic
1110094016 13:71492771-71492793 GTGTGTGTATGGTGTGAGGGAGG + Intronic
1110181772 13:72625979-72626001 CTGTGGGTTCTGTGGGAGCAGGG + Intergenic
1110474000 13:75891941-75891963 TGGTGGGTTTGGAGAGAGGAGGG - Intergenic
1111478234 13:88783315-88783337 CAGTGGGTGAAGTGTGAGGAGGG - Intergenic
1111520666 13:89399046-89399068 CTGGGGGTTAGGGATGAGGAAGG - Intergenic
1111746600 13:92278699-92278721 TTTTGTGTTGGGTGTGAGGAAGG + Intronic
1112462060 13:99611608-99611630 GTCTGGGTTTGGTATTAGGATGG + Intronic
1114083243 14:19219476-19219498 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1114275524 14:21140314-21140336 ATGTGGTTTTGGTGCAAGGATGG - Intergenic
1114657213 14:24323282-24323304 CTGTGGGCTTGGGCTGAGGAAGG + Intronic
1116497749 14:45583016-45583038 CCATGGGCTTGGGGTGAGGATGG - Intergenic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117222945 14:53624694-53624716 CTGAGGGTTCGGAGTAAGGAGGG + Intergenic
1117951709 14:61089524-61089546 CAGTGGCTTAGGTGGGAGGAGGG + Intergenic
1118619374 14:67600591-67600613 CTGTGGGTTTGTTTTGAGACAGG - Intergenic
1118764209 14:68899299-68899321 CTGTGGGTGTGGTGTGCTGTGGG - Intronic
1118879025 14:69810609-69810631 TTGTGGGCTTGGGGTGGGGAAGG - Intergenic
1119161031 14:72452650-72452672 CTGAGGCTTTGGTGAGAGGGAGG - Intronic
1119399204 14:74350229-74350251 CTGTGGGTTGGGAGTGAGTGTGG + Intronic
1119422177 14:74513909-74513931 CTGGGGCTCTGGTCTGAGGAAGG - Intronic
1119598593 14:75958966-75958988 GTGTGGGTTTGGTTAGAGGAAGG - Exonic
1119893303 14:78199309-78199331 CTGTGTGTTGGGTGTGGGGGGGG - Intergenic
1120394514 14:83952460-83952482 CAGTGGGCTAGGTGTGGGGACGG + Intergenic
1120957994 14:90099827-90099849 ATGTTGGTTTGGTATGAGAAAGG - Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121605459 14:95236875-95236897 TTGTGGGAATGGTGTGGGGAGGG + Intronic
1121627597 14:95397765-95397787 GTGTGTGTTTGGTGTGTGGGGGG + Intergenic
1122268221 14:100556612-100556634 CTGTAGGGCTGGGGTGAGGATGG - Intronic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1122743710 14:103885992-103886014 TTGTGGGGTAGGTATGAGGAAGG + Intergenic
1122819178 14:104332729-104332751 CTCTGGGTTCGGTCTGAGCAAGG - Intergenic
1123104857 14:105836562-105836584 GTTTGTGTTTGGTGTGGGGAGGG + Intergenic
1123190306 14:106563163-106563185 CTCTGGACCTGGTGTGAGGAGGG - Intergenic
1202894865 14_GL000194v1_random:1246-1268 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1124250787 15:28105406-28105428 GTGTGGGTGTGGTGTGTGTATGG + Intergenic
1124594469 15:31081647-31081669 CTGTGGCTTTGGTGCGAGGTTGG - Intronic
1125580694 15:40783395-40783417 CTCTGGGATGGGTGAGAGGAAGG + Intronic
1125592078 15:40860925-40860947 CTGGGAGTTTGGTGGGTGGAGGG + Intergenic
1125673195 15:41487966-41487988 GTGTGGGTGTGGTGTGAGTGTGG - Intergenic
1126068978 15:44849328-44849350 CTGCGGTTCTGGTGTGAGGTAGG + Intergenic
1126089840 15:45041445-45041467 CTGCGGTTCTGGTGTGAGGTAGG - Intronic
1127802939 15:62493377-62493399 CTGTAGGTTTGTTGTGCGGTGGG + Intronic
1127933345 15:63612482-63612504 CAGTTGTTTTGCTGTGAGGAGGG + Exonic
1128332780 15:66766707-66766729 CTGTGTGATAGGTGAGAGGAGGG - Intronic
1128658591 15:69481198-69481220 CTGTGGGTTGGGTGCGGGAATGG - Intergenic
1128845235 15:70888487-70888509 TTTTGTGTTTGGTGTGAGGTAGG - Intronic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1129126556 15:73446876-73446898 CTCTGGCTGTGGTGTGAAGATGG + Intronic
1129337889 15:74864706-74864728 CTGTGGGATTGATGTGAGGAAGG - Intronic
1130028256 15:80288735-80288757 CTGGGGACTTTGTGTGAGGATGG - Intergenic
1131022389 15:89109879-89109901 CTGTGGGTTTGGTATCTGCAGGG - Intronic
1131483983 15:92805273-92805295 CTGTAGGCTTGTTGTGAGGTTGG - Intronic
1131829280 15:96344014-96344036 CTCTGGGTTGGGGGTGAGGTGGG + Intergenic
1132083104 15:98884215-98884237 CTGTGGGTTGGGTGTGGGGGAGG - Intronic
1132698582 16:1212646-1212668 CTGGGCGTGTGGCGTGAGGAGGG + Intronic
1132819913 16:1859836-1859858 CTGCGGGTTTGGGGAGTGGATGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132952472 16:2571484-2571506 TTTTGTGTATGGTGTGAGGAAGG - Intronic
1132961879 16:2628686-2628708 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1133174873 16:4006563-4006585 CAGTGGGGTATGTGTGAGGATGG - Intronic
1133362288 16:5183999-5184021 CAGTGGGTGTGGTGTGACAATGG + Intergenic
1133726525 16:8542611-8542633 CTGTGGGTTTGGGGTGGGGGAGG + Intergenic
1133966017 16:10532186-10532208 CTGTAGGTCTGGGGTGAGGGGGG + Exonic
1134026271 16:10956412-10956434 CTGGGGGTCTGGTGAGAGCAAGG - Intronic
1135954144 16:26941495-26941517 ATGTGGGTTTCCTGTGATGAGGG - Intergenic
1136189446 16:28606930-28606952 AGGTGGGTTTGATGGGAGGAAGG - Exonic
1136238068 16:28926664-28926686 CTGTGGGGTGGGTGTTGGGAGGG + Intronic
1136552847 16:30990743-30990765 TTGTGGGTTTGGTGGCAGGTAGG - Exonic
1137427147 16:48389339-48389361 CTGTGGGTTGGGCATGAGGCAGG - Intronic
1137574552 16:49590350-49590372 CTGTGGCTTGGGTGTGAGCCGGG - Intronic
1137672424 16:50286845-50286867 CTCTGGGTATGGTGTGAGGTAGG - Intronic
1137719150 16:50617614-50617636 TCGTGGCTGTGGTGTGAGGAGGG + Intronic
1139950884 16:70668994-70669016 GTGTGTGTGTGGTGTGAGGTAGG - Intronic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1141186485 16:81791212-81791234 CACTGGATGTGGTGTGAGGAGGG + Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141330213 16:83104160-83104182 CAGTGGTTTTGATGTTAGGATGG - Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141787669 16:86212746-86212768 CAGTCTGTGTGGTGTGAGGAAGG - Intergenic
1141787732 16:86213034-86213056 CGGTCTGTGTGGTGTGAGGAAGG - Intergenic
1142012050 16:87720498-87720520 CTGTGGTTGTGTGGTGAGGAGGG - Intronic
1142032889 16:87847207-87847229 CTGTGGCTCTGGGGTGTGGAGGG - Intronic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1143152939 17:4818414-4818436 CTGTGGGTGTGGTTTGAGCCCGG + Intronic
1143867733 17:9936115-9936137 TTGTGTGTATGGTGTGAGGTAGG - Intronic
1143986377 17:10918136-10918158 ATATGGGTTTGGTTTTAGGAAGG - Intergenic
1144046941 17:11462432-11462454 CTCTGTATTTGGTGTGAGGGAGG - Intronic
1144754275 17:17669810-17669832 CTGTGGGATGGGGGTGGGGAGGG - Intergenic
1145749899 17:27348068-27348090 CTTTGGGTACGATGTGAGGAAGG - Intergenic
1146061112 17:29607886-29607908 CTGTGGGGCTGGGGTGAGCAGGG - Intronic
1146147649 17:30435481-30435503 TTTGGGGTGTGGTGTGAGGAAGG - Intronic
1146650185 17:34601778-34601800 CTGGGGTTTTGGGGTGGGGAAGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147331179 17:39700310-39700332 AGGTGGGTCTGGTGTGGGGAGGG + Exonic
1148829219 17:50419472-50419494 GTGTGCGTTTGGTGTGAGTATGG - Intergenic
1148894665 17:50832839-50832861 CCGTGGGTTTGGTGAGGGTAGGG + Intergenic
1149138542 17:53400776-53400798 CTTTGGGTTTGGGGGAAGGAAGG - Intergenic
1149505610 17:57191303-57191325 CTGTGGATTGGGTGAGAGGCAGG + Intergenic
1151009684 17:70480289-70480311 CAGTTGATTTGGAGTGAGGAAGG + Intergenic
1151209219 17:72531585-72531607 CAGTGTGTTTGGTGTTAGAAGGG - Intergenic
1151379752 17:73717570-73717592 CTGTGGGATCGGTGGGGGGAGGG - Intergenic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1151959998 17:77400769-77400791 CTGTGGGTCTGGCCTGGGGAAGG + Intronic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152648094 17:81479487-81479509 CTGTGAGGTTAGTGCGAGGATGG - Intergenic
1154961231 18:21310961-21310983 CTTTGGGTTTGGTGAGTAGAGGG + Intronic
1155451090 18:25963647-25963669 CAGTGGGTTTGGGGTGGGAATGG - Intergenic
1155963987 18:32019085-32019107 CTGAGGGCATGGTGTGGGGAAGG + Intronic
1157454213 18:47811610-47811632 GTGTATGTTTGGAGTGAGGATGG - Exonic
1157987147 18:52451082-52451104 CTGTGGGCATGTTGTGAGGCAGG + Intronic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1159090250 18:63840170-63840192 CTGTGTGTATGATGTGAGCAGGG - Intergenic
1159941722 18:74413444-74413466 CTGTGGTTTTTGTCTTAGGAAGG + Intergenic
1160357919 18:78244394-78244416 TTGGGGGTTTGGTTGGAGGAGGG - Intergenic
1160489014 18:79320905-79320927 CTGTGGGTTTTATGCGGGGAGGG + Intronic
1160632856 18:80258635-80258657 GTGTGGGTGTGGTGTGTGGGTGG + Intergenic
1160632866 18:80258659-80258681 GTGTGGGTGTGGTGTGGGGTGGG + Intergenic
1161010516 19:1957481-1957503 CCTTGGGTTTGCTGTTAGGAGGG + Intronic
1161289957 19:3488354-3488376 CTGTTGGTGGGGTGTGCGGAAGG + Intergenic
1162030556 19:7915466-7915488 AAGTGGGTGTGGTGTGCGGATGG + Intergenic
1162107528 19:8379072-8379094 CTCTGGGTTTGATGGGAGGGAGG + Intronic
1162762346 19:12896239-12896261 GTGTGGGCTCGGTGTGAAGATGG + Exonic
1163197218 19:15731205-15731227 CTTTGTGTATGGTGTGAGGTAGG + Intergenic
1163587760 19:18173280-18173302 GTGGGGGTTGGGTGTGAGGGAGG + Intronic
1163719404 19:18891576-18891598 CTGGGGGTTGGGGGTGTGGAGGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164594046 19:29522026-29522048 CTGTGGGTTTTCTGTGAGCAGGG - Intergenic
1165070114 19:33250847-33250869 CTGTGTGTGTGGTGTGAGTGTGG - Intergenic
1165150409 19:33756914-33756936 CTGTGGTTTAGGTGTGAGTGTGG + Intronic
1165318485 19:35072073-35072095 CTGTGGGTTTGATGTGGCGGTGG + Intergenic
1165591558 19:36973534-36973556 GAGTGGGTGTGGTGTGAGGCTGG + Intronic
1165683240 19:37795801-37795823 CAGTGGGTTTTGTGTAAGGTGGG - Intronic
1167450049 19:49561989-49562011 TTTTGTGTATGGTGTGAGGAAGG + Intronic
1167631362 19:50628154-50628176 CTGTGTGTGTGTTGTGGGGAGGG - Intronic
1167851586 19:52206319-52206341 CTGTGGGTTTAGAGTCAGGTTGG + Intronic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
927145846 2:20165793-20165815 CTGTGTGTTTTGTGTGAGTGTGG - Intergenic
927417552 2:22894385-22894407 CTGTGAGTTTCCTGAGAGGAGGG + Intergenic
928323390 2:30301534-30301556 CTCTGGGTCTGCTGTCAGGAGGG + Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928715818 2:34058981-34059003 CTTTGTGTTTGGGGTCAGGAGGG + Intergenic
928863162 2:35884820-35884842 TTGTAGGGTTGGTGTGAAGATGG - Intergenic
929794359 2:45047540-45047562 CTTGTGGTTTGGTGGGAGGAAGG + Intergenic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
932097012 2:68859814-68859836 CTGTGTGAATGGTCTGAGGAAGG + Intergenic
932597200 2:73101452-73101474 TTGTTGATTTTGTGTGAGGATGG + Intronic
932606921 2:73171664-73171686 CTGGGTTTTTGGTCTGAGGATGG + Intergenic
933189358 2:79316113-79316135 TTTTGTGTTTGGTGTGAGGAAGG + Intronic
933925507 2:87088747-87088769 CTGGGTTTTTGGTCTGAGGATGG - Intergenic
935362504 2:102259034-102259056 ATGTGTGTTTGGTGAGAGGAAGG - Intergenic
935953881 2:108355349-108355371 CTGTGGTTTGTGTGTGAGGATGG - Intergenic
935954586 2:108363044-108363066 CTGTGGGTGGGGTTTGGGGATGG + Intergenic
936070729 2:109369569-109369591 CTGGGGGTTGGGGGAGAGGATGG + Intronic
936150957 2:110022269-110022291 CACTGGGTTGGGTGTGTGGATGG - Intergenic
936253754 2:110890481-110890503 TTTTGTGTATGGTGTGAGGAAGG + Intronic
936341489 2:111637435-111637457 TTGTGTGTATGGTGTGAGGTAGG - Intergenic
936914068 2:117622212-117622234 CTGTGAGATTGGTGTGATGTGGG - Intergenic
937075666 2:119104541-119104563 CTGTGAGTCTGAGGTGAGGAGGG - Intergenic
937096705 2:119240432-119240454 CGGAGGGTTTGCTGTGAGGTCGG - Intronic
937309424 2:120892964-120892986 CTGTGGATTTGAAGTCAGGAAGG + Intronic
937916967 2:127103998-127104020 CTGTGGCCTTGGTGTGAGGAGGG - Intronic
938395898 2:130947746-130947768 TGCTGGGTTGGGTGTGAGGAAGG - Intronic
938493339 2:131777154-131777176 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
938976530 2:136483507-136483529 CTGTGGATCTGGTCTGAGCACGG + Intergenic
939709762 2:145502573-145502595 TTGTGGGTTTGTTTTGTGGAGGG + Intergenic
939733698 2:145817221-145817243 CTGTGGGGTTGGGGAGAGGGGGG - Intergenic
941026859 2:160465833-160465855 GTGTGTGTGTGGTGTGGGGAGGG - Intronic
941552316 2:166932706-166932728 TTGTGTGTCTGGTGTGAGGTAGG + Intronic
943013903 2:182487646-182487668 CTGTGGTTGGGGTGTGGGGATGG + Intronic
944537062 2:200721316-200721338 TTTTGTGTATGGTGTGAGGAAGG - Intergenic
945425659 2:209697333-209697355 CTGTGTGTTTGGTTAGACGATGG + Intronic
946390914 2:219416728-219416750 CTGTGGCTTTGGCCTCAGGATGG - Intergenic
946433391 2:219637212-219637234 GTGTGGGTGTGGTGTGAGTATGG + Intronic
946748047 2:222864814-222864836 CTGTGTCTTTGCTGGGAGGAGGG + Intronic
947285205 2:228506467-228506489 CCCTGGGTTTGGTGTGGGGGTGG + Intergenic
947299450 2:228672756-228672778 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
947359029 2:229328392-229328414 CAGTGGCACTGGTGTGAGGATGG + Intergenic
947715733 2:232338057-232338079 CTGGGGGTTTGGTGTTGGGGTGG + Intronic
947721267 2:232370434-232370456 CTGGGGGTTTGGTGTTGGGGTGG + Intergenic
947734762 2:232448817-232448839 CTGGGGGTTTGGTGTTGGGGTGG + Intergenic
947910358 2:233796501-233796523 CAGAGGGTTGGGTGTGGGGAGGG - Intronic
948426072 2:237887150-237887172 CTGTGGGTCCTGTGTGGGGAGGG + Intronic
948787211 2:240358919-240358941 CTCAGGGTGTGGTGTGGGGAGGG - Intergenic
1169268849 20:4183660-4183682 CGGGGCGTTTGGGGTGAGGAGGG + Intronic
1169630504 20:7625852-7625874 CTCTGGGTCTGCTGTGGGGAGGG - Intergenic
1169859049 20:10132604-10132626 CTGTGGGGGTGGTGTGGGGGAGG - Intergenic
1171360662 20:24584417-24584439 CTGTCGGTGTGTTCTGAGGATGG - Intronic
1171395308 20:24829264-24829286 CTGTGGGGTGGCTGGGAGGAGGG + Intergenic
1172027163 20:31956511-31956533 CTGTGGCTCTGGTGATAGGATGG + Intergenic
1172190455 20:33059272-33059294 CTGTGGGTTTGAGGTGAGATAGG + Intronic
1172446839 20:34997650-34997672 GGGTGGGTATGGGGTGAGGAAGG - Intronic
1173331620 20:42080296-42080318 ATGCAGGTTAGGTGTGAGGATGG + Exonic
1173558965 20:43988629-43988651 CTGTGGGTTTCGTGGGGGCAGGG + Intronic
1173591922 20:44231485-44231507 CTGTGGGTTGGGTGTGAGCTTGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175134085 20:56809979-56810001 CTGTTGGTTAGGTGGGAGAAGGG - Intergenic
1175312260 20:58020035-58020057 GTGTTGGCATGGTGTGAGGATGG + Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175753208 20:61513434-61513456 CTGTGGGGTTGCTGTGAGGTTGG - Intronic
1176614562 21:9017233-9017255 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1176739210 21:10583718-10583740 CTATGTGTGTGGTGTGAGGAAGG + Intronic
1177669978 21:24212419-24212441 CTGGGGTGTTGGTGTGGGGAGGG + Intergenic
1178245777 21:30950668-30950690 CTCTGTGTATGGTGTGAGGTAGG - Intergenic
1178788161 21:35673606-35673628 CTGTGGGGTGGGTCAGAGGAGGG + Intronic
1178899850 21:36590140-36590162 CTGTGGTTTTTGTTTCAGGATGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180294730 22:10873791-10873813 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180497536 22:15903205-15903227 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181682011 22:24501849-24501871 CTGTGGGGTTGCTGAGAGGCAGG - Intronic
1181967432 22:26666867-26666889 CTGTGGGGTCTGTGTGGGGAAGG + Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182446060 22:30390306-30390328 CTGCTGCTTTGGGGTGAGGAGGG + Intronic
1182857949 22:33534702-33534724 TTCTGGGTTTGGGGAGAGGATGG + Intronic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1183795195 22:40111558-40111580 CTGACAGTTTGGTGAGAGGAAGG + Intronic
1184735294 22:46394432-46394454 CTGTGGGTGGGGGGTGAGGTTGG - Intronic
1184978611 22:48080632-48080654 TTGTGGGTTTGGTGTGTGTGTGG - Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
949768695 3:7554649-7554671 GATTGGGGTTGGTGTGAGGATGG + Intronic
950715193 3:14842837-14842859 CTGTGTGTTGGGTGTGAGAATGG + Intronic
950821967 3:15769953-15769975 CTGTGAGTATGGTCTGAGCAAGG + Intronic
950918487 3:16668964-16668986 CTGTGGGTTTGGAGTTGGCAGGG + Intronic
950941275 3:16895386-16895408 TTGTGTGTGTGGTGTGAGGTAGG + Intronic
952791291 3:37202669-37202691 CTGTGTGTTTTGTGTGTGGGTGG - Intergenic
952836078 3:37603447-37603469 CTTGGGGTTTGGTGTCAGGGTGG + Intronic
952951512 3:38529321-38529343 CTGTAGATTTGGTGTGACGTTGG + Intronic
953474092 3:43191497-43191519 CTGGGGGTTTGGTGTGGTGGGGG - Intergenic
954506049 3:51074673-51074695 CTGGGGGTGTGGTGAGGGGAGGG + Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
956161795 3:66362778-66362800 CTGTGGGTTAGCTCTGGGGATGG - Intronic
956186898 3:66571260-66571282 CTGTGGGTTAGGTGGGGGTAGGG - Intergenic
956583867 3:70843225-70843247 CTGGGGGTATGGTTAGAGGAAGG + Intergenic
958026035 3:88050264-88050286 CTGGGGGTTGGGTGTGATTAGGG - Intergenic
959116947 3:102189767-102189789 CTGTGGGTGTGGCATGAGGAAGG + Intronic
959459296 3:106604750-106604772 CAGTGGGTTTGGTTTCAAGATGG + Intergenic
959894617 3:111592122-111592144 GTGTGTGTTTGGTTGGAGGAGGG + Intronic
960047509 3:113212067-113212089 CTGTTGGTTCGGGGAGAGGAGGG + Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
960942189 3:122942417-122942439 GTGTGGGGTTGGGGAGAGGATGG - Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961507769 3:127382522-127382544 GTTTGGGTTTGGTGAGAGGTGGG + Intergenic
961984090 3:131114004-131114026 CTGGGAATTTGGAGTGAGGAGGG + Intronic
962116342 3:132512764-132512786 CTGAGGGTTAGGGGTGGGGATGG + Intronic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
963603755 3:147397408-147397430 CTGTGGGGGTGGGGTGAGGGAGG - Intronic
963925841 3:150950132-150950154 TTTTGTGTTTGGTGTAAGGAAGG - Intronic
964740559 3:159960936-159960958 CTCTGTGTTTGATGTGGGGAGGG + Intergenic
965941479 3:174187856-174187878 TTGTGGGTTTGTTGGGAGGGTGG + Intronic
966852504 3:184172762-184172784 CTGGGGTTTTGGTGTGCAGAGGG + Exonic
967913908 3:194563947-194563969 CTTTGGCTTTGGCTTGAGGAGGG + Intergenic
968507456 4:977548-977570 CTGGGGGTGTCGTGTGAGGTGGG + Intronic
968700099 4:2051636-2051658 CTGGGGATTTGGTGTAAAGATGG + Intergenic
969263248 4:6046779-6046801 CTGTGGGTCGGGCGTGGGGAGGG + Intronic
969352887 4:6608328-6608350 CTGTGGGATTGTGGTGAGGGTGG - Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970558546 4:17260016-17260038 CTTTGGGGTTGGTGTGCTGATGG - Intergenic
971056904 4:22923289-22923311 ATGTGGGTTTTGTGTGGGGTTGG - Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971470312 4:27018026-27018048 TTGGGGGTAAGGTGTGAGGAGGG + Intronic
973774937 4:54233676-54233698 CTCTGGGTTTGGATTGAGAATGG + Intronic
975330603 4:73108224-73108246 TTGTGGGTTTGGGGTGGGCAAGG + Intronic
976078600 4:81328393-81328415 TTGTGCTTTTGGTGTAAGGAGGG - Intergenic
976099260 4:81543044-81543066 CTGTTGATTTGGGGTGGGGAGGG - Intronic
980595178 4:134946052-134946074 GTCTGGTTTTGGTGTTAGGATGG - Intergenic
981210131 4:142093342-142093364 CTGTGGGTTAGGTATCAGAAAGG - Intronic
981426923 4:144614159-144614181 CCATGGGTTTGGGGTAAGGATGG - Intergenic
982662873 4:158227972-158227994 GTGTGTGTGTGGTGTGAGCATGG - Intronic
982695730 4:158597810-158597832 CTGTGTGTATGCTGTGGGGATGG - Intronic
983518190 4:168678805-168678827 ATGTGGGTATGGTGTGTGGGGGG + Intronic
983902947 4:173155948-173155970 CTGTGGGTTTGCTGAGGGGTGGG - Intergenic
985842398 5:2317927-2317949 CTGTGGGTTTGGTGGGGCCATGG + Intergenic
986044547 5:4024667-4024689 CTGTTGGTGTTGTGAGAGGATGG - Intergenic
987930739 5:24397061-24397083 GTGTGCGTGTGGTGTGAGCATGG - Intergenic
988404974 5:30812471-30812493 CTGTGTCTTGGGAGTGAGGATGG + Intergenic
988687086 5:33535748-33535770 CTGGGGATTGGATGTGAGGAGGG + Intronic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
990271480 5:54146149-54146171 TTGTGTGTATGGTGTGAGGCAGG - Intronic
991042349 5:62189062-62189084 ATGTAGTTATGGTGTGAGGAAGG - Intergenic
992610668 5:78505548-78505570 CTGTGGCTTTGGTGTAACCAGGG - Intronic
995299279 5:110558730-110558752 CAGTGGATTTGGTGTGGGAATGG - Intronic
995847783 5:116512693-116512715 CTGTGTGTTTGGGGTGGGGGTGG - Intronic
995903315 5:117094261-117094283 CAGTGAGCTTGGTGTGGGGATGG - Intergenic
997646996 5:135488383-135488405 ATGGGGGTGAGGTGTGAGGAAGG + Intergenic
998377164 5:141698755-141698777 CTGGAGGCTTGGTGTGAGTAGGG + Intergenic
999210729 5:149886230-149886252 CGGAGGGTTGGGTGTGGGGAGGG + Intronic
999715425 5:154356370-154356392 CTGGGGGTTGGGTATGAGAAAGG + Intronic
999987669 5:157020233-157020255 GTGTGTGTATTGTGTGAGGAAGG + Intergenic
1000178364 5:158781889-158781911 CTGAGGGTTTGGTTTGAGGCAGG - Intronic
1000236588 5:159367147-159367169 GTGTGTGTGTGGTGTGAGTATGG + Intergenic
1000521558 5:162300462-162300484 CAGAGGGTTTGGTGTGGGAAAGG - Intergenic
1002140084 5:177133062-177133084 GTGTGGGTTTGGGGTGCGGCCGG + Intronic
1002444659 5:179282310-179282332 ATTTGTGTATGGTGTGAGGAAGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002690851 5:181049553-181049575 CTGAGGGTGAGGTGTGATGACGG + Intronic
1002999366 6:2317122-2317144 GTGTGCGTGTGGTGTGAGCATGG - Intergenic
1003161546 6:3638881-3638903 TTGTGTGTATGGTGTGAGGTAGG - Intergenic
1003243859 6:4367967-4367989 CTGTGGGTTTGTGATGAGGCTGG + Intergenic
1003278810 6:4674725-4674747 CTGTGGGGTACGTGTGAGGCTGG + Intergenic
1003397878 6:5769148-5769170 GTGTGTGTGTGGTGTGAGGTAGG + Intronic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1005024222 6:21447472-21447494 CCGTGTGTTTGCAGTGAGGATGG - Intergenic
1005025595 6:21460244-21460266 GTGTGGGTTTGGGTTGAGAAAGG + Intergenic
1006616013 6:35327455-35327477 CTGTGGCTTGTATGTGAGGATGG + Intergenic
1006933535 6:37701809-37701831 CTGGGGGTGTGGGATGAGGAGGG - Intergenic
1006971351 6:38048673-38048695 GTGTAGGATTGTTGTGAGGATGG - Intronic
1007149790 6:39678551-39678573 CTTTGAGTTTGGTGTGGGGTGGG + Intronic
1007321107 6:41029213-41029235 CTGTGGGTGTAGTGTGTGCAAGG - Intronic
1007379032 6:41474832-41474854 TTTTGGGTTTGGGGTGATGATGG - Intergenic
1009061530 6:58402436-58402458 CAGTGGGCCTGGTGTTAGGAAGG + Intergenic
1011640277 6:89411702-89411724 TTGAGGGTTTGGGGTGGGGAGGG - Intronic
1011713476 6:90079279-90079301 TTGTGTGTTTGGTTGGAGGAGGG - Intronic
1012113840 6:95268450-95268472 ATGTGGGTTAAGTGTGAGGAAGG - Intergenic
1012593714 6:101015713-101015735 CTGTGAGTTTGGTGTCCAGATGG - Intergenic
1013434797 6:110092468-110092490 CTTTGTGTGTGGTGTGAGGTGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014854784 6:126386374-126386396 CTGCTAGTTTGGTGCGAGGATGG - Intergenic
1015187301 6:130432813-130432835 CTGTAGGATTGTTGTGAAGAGGG - Intronic
1015497062 6:133893180-133893202 CTGTGGGGTTGGTGGAAGGGCGG - Exonic
1017072347 6:150586751-150586773 TCGTGGGTTTGGTGTAGGGATGG - Intergenic
1017881596 6:158566169-158566191 CCAGGGGTTTGGTGTGAGGCAGG + Intronic
1018299592 6:162387521-162387543 GTGTGTGTGTGTTGTGAGGAGGG - Intronic
1018849470 6:167576696-167576718 CTGGGACTTTGGGGTGAGGAGGG - Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019127275 6:169849202-169849224 CTGTGGGTTTGGGGTGCTGCCGG - Intergenic
1019188281 6:170234065-170234087 CTGTGTGTTCTGTGTGGGGAGGG - Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020338406 7:7083213-7083235 CTGTGGGTCAGGTGTGAGACTGG - Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1021404475 7:20248817-20248839 CTGTGGATTTGGGGTAAGGGAGG - Intergenic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022812731 7:33885557-33885579 GTGTGTGTTTGGTGGGGGGATGG - Intergenic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023344771 7:39260101-39260123 TTGTGTGTGTGGTGTGAGCATGG - Intronic
1023344795 7:39260381-39260403 CTGTGTGTGTGGTGTGAGCAAGG - Intronic
1023529414 7:41137037-41137059 CAGTGGGGTTGGTGTGACCAGGG - Intergenic
1023630351 7:42157458-42157480 CTGGGGCTGTGGTGTGAGGAAGG - Intronic
1023777769 7:43625549-43625571 ATGTGAGTGTGGTGTGATGAGGG - Exonic
1024336807 7:48216753-48216775 TTTTGTGTATGGTGTGAGGAAGG + Intronic
1026896482 7:74012849-74012871 CTGTGAATGAGGTGTGAGGAAGG + Intergenic
1027557385 7:79682792-79682814 GTGTGTGTGTGGTGTGTGGAAGG + Intergenic
1027906794 7:84195514-84195536 CAGGGGGTTTGTTGGGAGGAGGG - Intronic
1028019986 7:85758432-85758454 CTTTGTGTATGGTGTAAGGAAGG - Intergenic
1028405614 7:90470625-90470647 CTGTGGATTTGGTTTTAGTAAGG - Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028702391 7:93795308-93795330 CTGGGGGTGTGGTGAGGGGAGGG - Intronic
1029056481 7:97749985-97750007 TTTTGTGTATGGTGTGAGGAAGG - Intergenic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1031165985 7:118227548-118227570 TGGTGTGTTTGTTGTGAGGAAGG + Intronic
1032310620 7:130782869-130782891 CTTTGTGTTTGGTGTGAAGTAGG + Intergenic
1032401303 7:131626226-131626248 AGGTGGGTTTGGTGGGAGCAGGG - Intergenic
1032718128 7:134528305-134528327 CTGTGGGTTTGTTGTGGGCTGGG + Intronic
1032722976 7:134565874-134565896 CTGTGGGTTTGTTGTGGGCTGGG + Intronic
1033281477 7:140009583-140009605 GTGTGGGGTGGGTGTGGGGAAGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1035477085 7:159151446-159151468 CTGAGGGTTGGGGGTGAGCAGGG - Intergenic
1036769026 8:11566094-11566116 CTGTGGGGTGGGGCTGAGGAGGG + Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037604957 8:20430315-20430337 CTGAGGGGTTAGCGTGAGGACGG + Intergenic
1037801130 8:22036628-22036650 CTGTGGCTTTGGCCTGTGGAGGG - Exonic
1037874220 8:22531498-22531520 CTGAGGGTTGGATGTGAGGAAGG + Intronic
1038798528 8:30729585-30729607 GTGTGCGTTTGGTGTGAGCTTGG + Intergenic
1038949412 8:32398306-32398328 CAGTGGGGTTGCTGTGAGGGTGG - Intronic
1039014144 8:33127514-33127536 CAGTAGGTTTGGTGTGGGGGTGG - Intergenic
1039343347 8:36675081-36675103 CTGTGTGTTTGGTGTGTGGGGGG + Intergenic
1040370913 8:46772730-46772752 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1041226667 8:55707051-55707073 GTGTGTGTGTGGTGTGAGCATGG + Intronic
1041526366 8:58810834-58810856 CTGTGGTCTTTGTGTGGGGAAGG - Intronic
1042739372 8:72026247-72026269 CAGTGGGTGAGGTGAGAGGAAGG - Intronic
1043130611 8:76456144-76456166 TTGGGGGTGTGGGGTGAGGAAGG + Intergenic
1043507675 8:80918807-80918829 CTGTGGTTTCAGTCTGAGGAGGG + Intergenic
1044255326 8:90053498-90053520 TTGTGTGTTTGGTGAGAGGTGGG - Intergenic
1044500924 8:92955396-92955418 TTTCGTGTTTGGTGTGAGGAAGG - Intronic
1044502463 8:92974340-92974362 CTGTTGGATTGGTTTGAGGTGGG - Intronic
1044744962 8:95362865-95362887 CTGTGGGGTTGCTGTGCTGATGG + Intergenic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048222451 8:132554169-132554191 CTGGGGCTTTGGTTTGGGGATGG + Intergenic
1048296599 8:133219285-133219307 CTGTGGGAGAGGTCTGAGGAGGG - Intronic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049286690 8:141779658-141779680 GTGTTGGTGTGGTGTGATGATGG + Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049440295 8:142606490-142606512 CTGTGGCTGTTGGGTGAGGAAGG - Intergenic
1049543205 8:143217984-143218006 GTGTGGGGGTGGTGTGGGGATGG - Intergenic
1049773598 8:144394816-144394838 CTGTGGGATGGCTGTGGGGATGG + Intronic
1049822970 8:144647331-144647353 CTGCGGGTTTCATGTGAGGATGG - Intergenic
1049965555 9:776119-776141 CTGTGGGTCTGGTTTCAAGATGG - Intergenic
1050119029 9:2289135-2289157 CTATGACTGTGGTGTGAGGAGGG + Intergenic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050614423 9:7387434-7387456 CAGTGGGTATGGTGTGAGATAGG - Intergenic
1052443132 9:28524242-28524264 TTGTGTGTATGGTGTGAGGTAGG - Intronic
1052778865 9:32760128-32760150 CTTTAGGGTTGCTGTGAGGAGGG + Intergenic
1054923388 9:70564226-70564248 CTGTTGTTTTGGTTTGAAGAAGG - Intronic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1056132492 9:83600138-83600160 CTGTGGGTCTGCCGTGGGGAAGG - Intergenic
1056493338 9:87130113-87130135 CTTTGTATATGGTGTGAGGAAGG + Intergenic
1057147407 9:92767611-92767633 CTGTGGGGCAGGTCTGAGGAGGG + Intergenic
1057172568 9:92971959-92971981 CTGTGGGGTTGGTGTGGGGGAGG - Intronic
1059037849 9:110777687-110777709 TTGAGGGTTTGCTGTGTGGAAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059242215 9:112816255-112816277 CTGTGCGGGTGGTGTGGGGATGG + Intronic
1059252808 9:112902353-112902375 GTTTTGGTTTGGTGTAAGGAAGG + Intergenic
1059426189 9:114222373-114222395 CTGGGGGTTTGATGAGAGAAGGG - Intronic
1059453508 9:114385760-114385782 CTGGGGCTTTGTGGTGAGGAGGG - Intronic
1059624391 9:116046077-116046099 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1059705459 9:116819213-116819235 CTGTGTGTTTGGGGTGGGGTGGG - Intronic
1060795987 9:126513635-126513657 CTGTGGGGTTAAGGTGAGGATGG + Intergenic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1061381271 9:130259632-130259654 CTTTGTGTCTGGTGTGAGGCAGG + Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061451763 9:130670749-130670771 GTGTGGGGTTGGTGAGGGGATGG - Intronic
1061616473 9:131783263-131783285 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1061741797 9:132712118-132712140 CTTTCTGTATGGTGTGAGGATGG - Intergenic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062021713 9:134322664-134322686 CTTTGGGTTTGGGGTGTGCAGGG + Intronic
1062078090 9:134603051-134603073 CTGCTGGTGTGGTGCGAGGATGG + Intergenic
1062184527 9:135210895-135210917 ATGGGGGTTCTGTGTGAGGAAGG - Intergenic
1186558808 X:10589044-10589066 GTGTGCGTGTGGTGTGAGCATGG - Intronic
1187441828 X:19327823-19327845 CTGTGGGGTTGGGTTGAGAAAGG - Intergenic
1188048402 X:25454491-25454513 CTGTGTGTTTGGTGAGGAGATGG - Intergenic
1188333381 X:28898431-28898453 GTTTGTGTGTGGTGTGAGGATGG + Intronic
1188456203 X:30369364-30369386 CTGAGTGTGTGTTGTGAGGAGGG - Intergenic
1188958607 X:36463906-36463928 CAGTGGGTCTGGTATGGGGATGG - Intergenic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1190426413 X:50337732-50337754 GTGTGCGTGTGGTGTGAGCATGG - Intronic
1191215252 X:57926808-57926830 CTGTAGGTTTGGAGTGTGTATGG - Intergenic
1191639036 X:63410246-63410268 GTGTGCGTGTGGTGTGAGCATGG + Intergenic
1192134254 X:68582279-68582301 CTGAGGGTGTGGTGTGTGCAGGG - Intergenic
1192595173 X:72399153-72399175 TTTTGTGTTTGGTGTGAGGTAGG + Intronic
1193595602 X:83440734-83440756 CTTTGTGTATGGTGTAAGGAAGG + Intergenic
1194206623 X:91018718-91018740 CTGTGGGAGTGGTTTCAGGATGG + Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194427300 X:93755289-93755311 CCATAGGTTTGTTGTGAGGATGG - Intergenic
1195335372 X:103848319-103848341 ATATGGGATTGGGGTGAGGAGGG - Intergenic
1195423283 X:104699162-104699184 CTGTGGACTTGGTGGGGGGATGG + Intronic
1195493570 X:105502948-105502970 TTGTGGCATTGGTGTGGGGATGG + Intronic
1196815130 X:119659424-119659446 CTTTGGGTTTGGTGATATGAAGG - Intronic
1197177440 X:123500691-123500713 CCGAGGGTTTGGTTTGAGAATGG - Intergenic
1197335086 X:125203366-125203388 CTGGGTGCTTGGGGTGAGGATGG - Intergenic
1197610177 X:128629465-128629487 GTGTGTGTGTGGTGTGAGGGTGG - Intergenic
1199000345 X:142628995-142629017 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1199408064 X:147485786-147485808 CAGAGGGTTTGGTGTGGGAATGG - Intergenic
1199767225 X:150950037-150950059 AAGTGGGGTTGATGTGAGGAGGG + Intergenic
1199912994 X:152307925-152307947 CAGAGGGTTTGGCGTGAGAATGG + Intronic
1200084248 X:153595571-153595593 CTGTGGGTGTGGCGTGGGCATGG - Intronic
1200552371 Y:4593507-4593529 CTGTGGGAGTGGTTTCAGGATGG + Intergenic