ID: 971137529

View in Genome Browser
Species Human (GRCh38)
Location 4:23886167-23886189
Sequence CTTGGAAGGCAGGGCCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 2, 1: 0, 2: 0, 3: 46, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971137529_971137539 24 Left 971137529 4:23886167-23886189 CCCTCATGGCCCTGCCTTCCAAG 0: 2
1: 0
2: 0
3: 46
4: 380
Right 971137539 4:23886214-23886236 TTCACATCCAGGCTGCAGTTAGG 0: 1
1: 1
2: 1
3: 16
4: 226
971137529_971137537 -4 Left 971137529 4:23886167-23886189 CCCTCATGGCCCTGCCTTCCAAG 0: 2
1: 0
2: 0
3: 46
4: 380
Right 971137537 4:23886186-23886208 CAAGGTCAGGAGAGATGCTGTGG 0: 1
1: 0
2: 2
3: 37
4: 367
971137529_971137538 13 Left 971137529 4:23886167-23886189 CCCTCATGGCCCTGCCTTCCAAG 0: 2
1: 0
2: 0
3: 46
4: 380
Right 971137538 4:23886203-23886225 CTGTGGAATTGTTCACATCCAGG 0: 1
1: 0
2: 1
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971137529 Original CRISPR CTTGGAAGGCAGGGCCATGA GGG (reversed) Intronic
900359102 1:2279384-2279406 CTTGGAGAGCAGGGCCAGGAAGG - Intronic
900744286 1:4350840-4350862 CTGGAAAGGCAGGGCCAAGTAGG + Intergenic
902113584 1:14103022-14103044 CTTGGGAGGCTGAGGCATGAAGG - Intergenic
902300969 1:15502539-15502561 CTGGGAAGGCTGGGCCGTGCTGG + Intronic
902511988 1:16971661-16971683 CTTAGAAGGCTGGGCCAGGATGG + Intronic
903611530 1:24618291-24618313 CTTGGGAGGCTGGGGCAGGAGGG + Intergenic
904292633 1:29497729-29497751 CCTGGAAGCCTGGGCCATGCAGG - Intergenic
905328418 1:37174956-37174978 GTCTGCAGGCAGGGCCATGAGGG - Intergenic
905659668 1:39711840-39711862 CTTGGAAGGGAATGTCATGAAGG + Intronic
907258883 1:53201107-53201129 CTTGGAAGGGAGGTCCATTGAGG + Intronic
908231576 1:62110782-62110804 CTTGGGTGGAAGGGCCATGTGGG - Intronic
909415634 1:75402731-75402753 CTTGGAACCCAGGGCCCTGGTGG - Intronic
910040806 1:82849747-82849769 CTTGGAAAGCACTGGCATGAAGG - Intergenic
910271462 1:85399768-85399790 CTTGAAAGGCAGGGACAGGGAGG - Intronic
912711116 1:111950610-111950632 CTTGAAAGGCAGGCAGATGAAGG + Intronic
912827906 1:112923418-112923440 CGTGGAGGGCCGGGACATGATGG - Intronic
913229336 1:116728774-116728796 CAGGGAAGGCAGGGCCAAGGAGG - Intergenic
914357429 1:146898928-146898950 CTGGGAGGGCAGGGCGATGTCGG - Intergenic
914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG + Intronic
915350078 1:155218745-155218767 CTTTGAATCCAGGGCCATCATGG - Intergenic
915353476 1:155240983-155241005 CTTTGAATCCAGGGCCATCATGG - Intronic
915588353 1:156857344-156857366 CTGGAGAGGCAGGGGCATGATGG - Intronic
915992313 1:160530069-160530091 CTTGGAACCCAGGGCCCTGGTGG + Intergenic
917737426 1:177933391-177933413 CTTGGAAGTCTGGGCTCTGATGG - Intronic
918195619 1:182218796-182218818 CTTGAAACCCAGGGCCCTGATGG - Intergenic
918526080 1:185466524-185466546 CCTGGAAGGCAAGGCCAGAATGG + Intergenic
919598950 1:199599468-199599490 CTTGAAACCCAGGGCCCTGATGG - Intergenic
921100386 1:211923714-211923736 CTGGGGAGGCAGGCCCATTATGG + Intergenic
921200863 1:212804745-212804767 CTTGAAGGGCAGGGGCAAGAAGG + Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
922229966 1:223677233-223677255 CTTAGAAAACAAGGCCATGAAGG + Intergenic
922242734 1:223766660-223766682 CTTAGAATGCAGGCCCATGGCGG + Intronic
1065520869 10:26570580-26570602 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1070225275 10:74497721-74497743 CTTGGGAGGCAGAGACAGGATGG + Intronic
1070312399 10:75283306-75283328 CTTGGAGGGCGGGGCCAGGCAGG - Intergenic
1070564604 10:77594196-77594218 CTTGGATGGCAGGGACAGAACGG - Intronic
1070789190 10:79179667-79179689 CTGGGAAGGAGGGGCCAAGAGGG + Intronic
1071573317 10:86709744-86709766 CTGTGAAGGAAGGACCATGAGGG - Intronic
1071604189 10:86973240-86973262 CCTGGAGGGCAGGGCCAGGTGGG + Intronic
1072605248 10:96975905-96975927 CTTGGGAGGCTGAGCCAGGAGGG + Intronic
1072732891 10:97859605-97859627 CTTGGAACCCAGGGCTGTGATGG + Intronic
1073104474 10:101024349-101024371 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1074436871 10:113441847-113441869 CTTGGAAGGCAGGGCCATGAGGG + Intergenic
1074831749 10:117254469-117254491 CTTGGGAGGCCTGGCCATGGGGG + Exonic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1076026857 10:127122563-127122585 CATGGATGGCTGGGTCATGAAGG + Intronic
1076089612 10:127670829-127670851 ATTTGAAGACAGGACCATGATGG + Intergenic
1076331596 10:129674524-129674546 CTTTGAGAGCAGGGCCTTGATGG + Intronic
1076368118 10:129935327-129935349 CTGGGAAGGCAGGGCCACCCTGG - Intronic
1078616502 11:12870776-12870798 CTTGGGAGGCTGGGGCAGGAGGG + Intronic
1080092671 11:28366981-28367003 CTTGGAAGGAAGGGTTATCATGG - Intergenic
1080590904 11:33722463-33722485 CCTGGAAGGAAGGGACAGGAAGG + Exonic
1081433863 11:43005500-43005522 TTTGGAAGGTAGAGCCAAGATGG - Intergenic
1082814836 11:57500998-57501020 CCGGGAGGCCAGGGCCATGAGGG + Exonic
1083171401 11:60925597-60925619 CTTGGTGGGGAGGGCCAGGAAGG + Intronic
1083368460 11:62158129-62158151 CTTGAAACCCAGGGCCCTGATGG - Intergenic
1083846653 11:65338457-65338479 AATGGAAGGCAGGGCCAGGCTGG - Intronic
1083882535 11:65555595-65555617 TCTGGAAGGCAGGGCCAGGCTGG + Intronic
1083934792 11:65864619-65864641 CTGGGAGGGCAGGGCCAGGCAGG + Intronic
1084533911 11:69745784-69745806 CAGGGAAGCCAGGGCCAGGAAGG + Intergenic
1084841939 11:71860066-71860088 CTTGAAAGGCAGGCCTCTGAAGG - Intergenic
1085018984 11:73193217-73193239 GTTGGAAGGTAGGGGGATGAGGG + Intergenic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1085683835 11:78603540-78603562 CTTGAAACCCAGGGCCCTGATGG + Intergenic
1085908858 11:80797830-80797852 CTTGAAACCCAGGGCCCTGATGG - Intergenic
1088004725 11:104926773-104926795 CTAGGTGGGCAGGGCCAAGATGG + Intergenic
1088066368 11:105725588-105725610 ATTGGAAAGCAGGGGCAAGATGG + Intronic
1088885116 11:114000171-114000193 CTAGGAAGGCAGGGACATGGGGG - Intergenic
1089150113 11:116357835-116357857 CTTGGAAGGCAGGGCCACTTTGG - Intergenic
1089170738 11:116509775-116509797 CTAGGAAGGCACGGCCAGGGAGG + Intergenic
1089857337 11:121557758-121557780 CTGGGAAGGCAGGGGAAAGATGG - Intronic
1090582759 11:128178079-128178101 CTTGGAAAACAGGGGCAAGATGG - Intergenic
1090837568 11:130464482-130464504 CTGGGAAGACAGGGCCTTGGTGG - Intronic
1091447825 12:554039-554061 CCTGGAAGGCAGGGGCCTAAGGG + Intronic
1093336092 12:17906158-17906180 CTTGGAACCCAGGGCCCTGGTGG + Intergenic
1093706062 12:22276095-22276117 CTTGGTAGGCAGAGGCCTGAGGG - Intronic
1095370288 12:41458806-41458828 CTTGGAAGACATGGCAGTGAAGG + Intronic
1095393682 12:41739582-41739604 CCATGAAGGCAGTGCCATGATGG - Intergenic
1095674197 12:44897654-44897676 CTTGAAAGCCAGGGCCCTGGTGG - Intronic
1098052886 12:66472860-66472882 CTTGAAACCCAGGGCCATGGTGG - Intronic
1098459514 12:70716737-70716759 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1098697020 12:73572434-73572456 CTTGGAACCCAGGGCCCTGGTGG - Intergenic
1100162560 12:91877111-91877133 TGTGGACAGCAGGGCCATGAGGG + Intergenic
1101598774 12:106190189-106190211 CTTGGAAGGCCTGGCGATGCTGG - Intergenic
1102251344 12:111389624-111389646 ATTGGAAGGCAGGTCCAGGAAGG + Intergenic
1102304116 12:111791792-111791814 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1104611840 12:130235173-130235195 CTTGGAGGGAAGGGCAGTGAAGG + Intergenic
1104795524 12:131514529-131514551 CATGGAAGGCAGGGGCATCATGG - Intergenic
1104965057 12:132505288-132505310 CGTGGAAGGAAGGGCCCAGAAGG - Intronic
1105824022 13:24106139-24106161 CTTGGGAGGCTGGGGCAGGAGGG - Intronic
1105887292 13:24652746-24652768 GGCCGAAGGCAGGGCCATGATGG - Intergenic
1107450502 13:40504486-40504508 CTTGGCTGGCAAGGCCCTGAGGG - Intergenic
1108574860 13:51782234-51782256 CTTGGGAGCCAGGCACATGATGG + Intronic
1108957685 13:56182127-56182149 ATTGGCAGGCAGGGCCAAGATGG + Intergenic
1109583996 13:64374253-64374275 CTTGGAAGACAGGGAGATGTAGG - Intergenic
1110848174 13:80213381-80213403 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1112467608 13:99657980-99658002 CTCCGAAGGCAGGGCGAGGAAGG - Intronic
1112492593 13:99880784-99880806 CTCAGAGGCCAGGGCCATGAGGG - Intronic
1112861060 13:103830125-103830147 CTTGAAACCCAGGGCCCTGATGG + Intergenic
1113406247 13:110043113-110043135 CTTGCACAGCAGGGCCCTGAAGG - Intergenic
1114265240 14:21069768-21069790 CTAGGCAGGCAGGGGCCTGAAGG + Intronic
1115626471 14:35198288-35198310 CTCAGAGGGCAGGGCCATGTGGG + Intronic
1117696649 14:58371171-58371193 CTTGGAAGGCTGAGGCAGGAGGG + Intronic
1119105163 14:71916708-71916730 CTTGGCAGGGTGGCCCATGAAGG + Intergenic
1119747703 14:77056124-77056146 CTGGGAGGGAAGGGCCAAGAAGG + Intergenic
1121043738 14:90773069-90773091 CGTGGCAGGCAGGGCCTTCAGGG + Intronic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1121444545 14:93970218-93970240 CTGGGAAGGCGGGGCCAAGAAGG + Intronic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1123923359 15:25086341-25086363 CATGGAAGGCAGGCCCATGTTGG + Intergenic
1125519970 15:40343106-40343128 CTTGGAGAGCAAGGCCAGGAAGG - Intergenic
1126339465 15:47623193-47623215 CTTGGAAGGCAGGACCAGCATGG - Intronic
1129499201 15:76019465-76019487 CTTGAAACTCAGGGCCCTGATGG + Intronic
1129658921 15:77542359-77542381 CTTGGAAGGAAGGTCGATGTGGG + Intergenic
1129742099 15:77994276-77994298 CTTGGAAGGGAGTGCCACCAGGG - Intronic
1129843384 15:78757193-78757215 CTTGGAAGGGAGTGCCACCAGGG + Intergenic
1130136678 15:81187485-81187507 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1132501041 16:284806-284828 CATGGGGGGCCGGGCCATGAGGG + Intronic
1135058089 16:19247469-19247491 CTTGGGAGGCCGGGACAGGAGGG - Intronic
1136228920 16:28875872-28875894 TTTGGAAGGCAGGTCCCTGAAGG - Intergenic
1139976757 16:70818366-70818388 CTGGGAGGGCAGGGCGATGTCGG + Exonic
1140901382 16:79371161-79371183 CCTGGAGGGCTGGGCCCTGATGG + Intergenic
1141655404 16:85413326-85413348 GGAGGAAGGCAGGGCCATGGAGG + Intergenic
1143490626 17:7283503-7283525 CTGGGGAGGCAGGGGCCTGAGGG + Exonic
1144193393 17:12867346-12867368 CTAGCAGGGCAGGGCTATGACGG - Intronic
1144828157 17:18118106-18118128 CTCAGAAGGCAGGGCAAGGAGGG - Intronic
1145815505 17:27792663-27792685 CTTTGAATGCAGGTCCTTGAGGG - Intronic
1146109846 17:30078993-30079015 CTTAGAACGCATGGCCCTGAGGG + Intronic
1146169371 17:30621260-30621282 CTTGGGAGGCAGGGCCCTAGAGG + Intergenic
1146170191 17:30626189-30626211 CTTGGGAGGCAGGGCCCTAGAGG - Intergenic
1146343643 17:32042218-32042240 CTTGGGAGGCAGGGCCCTAGAGG - Intronic
1146742785 17:35301185-35301207 CTTGAAATCCAGGGCCATGGTGG - Intergenic
1148249141 17:46059509-46059531 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1148351709 17:46946028-46946050 CTTGGAAGGCGGGGCCTCCAGGG + Intronic
1149229813 17:54519638-54519660 CATAGGAGGCAGGGCCAAGAAGG - Intergenic
1150006224 17:61470597-61470619 CTTGGAAGGCAGGTTCAGGAGGG + Intronic
1150782294 17:68133784-68133806 CTTGGGAGGCGGGGCCCTGCAGG + Intergenic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151517794 17:74607611-74607633 TGTGGAAGGCAGAGCCATGGAGG + Intergenic
1151517809 17:74607666-74607688 CGTGGAAGGCAGAGCCATGGAGG + Intergenic
1151891916 17:76956170-76956192 CTTGGAGGGCAAAGCCATGAGGG - Intergenic
1151942769 17:77303016-77303038 CTTGGAACGCCGGCCCATGGTGG + Intronic
1153128093 18:1820463-1820485 CTTGGGAGGCTGGGGCAGGAAGG - Intergenic
1153392505 18:4578418-4578440 CTGCCAAGGCTGGGCCATGATGG - Intergenic
1153768216 18:8394876-8394898 CATGGAAGGCACTGCCAGGAAGG - Intronic
1153818299 18:8809883-8809905 GGTGGGAGGCAGGGCCATGGAGG + Intronic
1153841434 18:9011541-9011563 CTGGGAAGGCAGGGCTGTGGTGG + Intergenic
1154382275 18:13863343-13863365 CTTGCAACCCAGGGCCTTGATGG + Intergenic
1155080754 18:22407694-22407716 TGTGGAAGGCAGGGCCAGGGTGG - Intergenic
1157043267 18:44064151-44064173 CTGGGAAGGGAGGGACATGATGG + Intergenic
1157125961 18:44956185-44956207 CTTGGAAGGGAGGGGAATAAGGG - Intronic
1158511569 18:58095234-58095256 CTTGGCACCCAGGGCCATGGAGG + Intronic
1159116795 18:64123753-64123775 GTTGGAAGGCAGGGCCTGGTAGG + Intergenic
1159901721 18:74053288-74053310 CTTGAAAGCCAGGGCCCTGGTGG - Intergenic
1160466699 18:79083511-79083533 CTTGAAATGCAGGGCCCTGGTGG + Intronic
1160975171 19:1789491-1789513 CTTGGACGCCAGGTCCACGAAGG + Exonic
1161238649 19:3210000-3210022 CTTGGAAGACAGGGACAAGGTGG - Intergenic
1161323755 19:3653203-3653225 CTGGGCAGGCAGGGCCAGGGAGG - Intronic
1161453896 19:4360915-4360937 CTTGGGAGGCAGGGCCCTGCAGG + Exonic
1162723202 19:12674549-12674571 CTTGGAGGGCAGGCACATCAAGG + Intronic
1162725254 19:12686441-12686463 CTAGAAAGGCAGCTCCATGAGGG + Intergenic
1162775222 19:12975195-12975217 CCTGGAGGGGAGGGTCATGAAGG + Intergenic
1162806284 19:13139449-13139471 CTTGGAAGGCAGGGCGGTGTTGG + Exonic
1163167491 19:15508173-15508195 CCTGGAAGTAAGGGCCATGGGGG + Intergenic
1163583457 19:18151886-18151908 TTTTAAAGGCAGGGCTATGATGG - Intergenic
1163695523 19:18761515-18761537 CTTGGAAGGCAGCACCAGGCAGG + Intronic
1164638018 19:29805647-29805669 CCTGGAGGGCAGGGCCATGTCGG + Intergenic
1164703886 19:30305068-30305090 CTTGGAAGGCAGGAGGCTGAGGG + Intronic
1165280768 19:34795380-34795402 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1165786183 19:38463351-38463373 CTTGGAAAGAGGGGTCATGATGG + Intronic
1165932667 19:39370006-39370028 CTGGGGAGGCAGGGCCAGGCTGG + Exonic
1165944621 19:39434383-39434405 CTAGGCTGGCAGGTCCATGAAGG + Intronic
1166263149 19:41657073-41657095 CTTGAAACCCAGGGCCCTGATGG - Intronic
1166327461 19:42059910-42059932 TTTGGAAGGGAGGGCCTTGATGG - Intronic
1167176543 19:47868383-47868405 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1167341817 19:48921035-48921057 CTGGGAGGCCAGGGCCATGTGGG - Intronic
1167502084 19:49854186-49854208 CTGGGAAGGAAGGGTCCTGAGGG + Intronic
1168149691 19:54438949-54438971 CATGAAAAGCAGGGCCAGGATGG - Intergenic
925617931 2:5761766-5761788 ATTAGAAGGCAGGGGCAGGAGGG - Intergenic
925898649 2:8493085-8493107 TTTGGGAGGCAGGGGCAGGAGGG - Intergenic
926681074 2:15664776-15664798 CTTTGCAGGCCGGGCCACGACGG + Intergenic
927893076 2:26764491-26764513 CCAGGAGGGCAGGGCCAAGAAGG - Intronic
927940991 2:27102631-27102653 GTTGGCAGGCTGGGCCCTGAGGG - Intronic
928558867 2:32456997-32457019 CTTGGGAGACAGGGGCAGGAGGG - Intronic
928611661 2:32997629-32997651 CTGGTAAGGCAGGGGAATGAAGG - Intronic
928803583 2:35124915-35124937 AATGGAGGGCAGGGCCAAGATGG + Intergenic
929299547 2:40287662-40287684 CTGGGAGGACAGGGCCATGAAGG + Intronic
929477658 2:42268542-42268564 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
929837977 2:45425883-45425905 CTTGAAACCCAGGGCCCTGATGG - Intronic
929963882 2:46519156-46519178 CTTGGCACCCGGGGCCATGACGG + Exonic
930167371 2:48216461-48216483 CTTGGAAAGTAGGGCCAAGGAGG + Intergenic
931156246 2:59634024-59634046 CTTGGGAGACAAGGACATGAAGG - Intergenic
932418378 2:71587069-71587091 CTTGGGAGGCAGGGACACTAAGG - Intronic
932630280 2:73336023-73336045 CTTGGAAGGCTGAGGCAGGAAGG + Intergenic
933645280 2:84807711-84807733 ATTGGGAGGCAGAGCCCTGAAGG - Intronic
934689371 2:96346586-96346608 CTCGGAAGACAGGGGAATGAGGG + Intronic
935971997 2:108538795-108538817 CTTGGAAGGAAGGGTAGTGATGG - Intronic
937126540 2:119478416-119478438 TTTGGAAGGCCAGGCCATTAGGG + Intronic
937251711 2:120528067-120528089 CATGGAATGCAGGGTCATGTGGG + Intergenic
937526087 2:122772094-122772116 CTTGAAACCCAGGGCCCTGATGG - Intergenic
937573469 2:123391708-123391730 CTTGAAATGCAGGGCCCTGGTGG - Intergenic
938278856 2:130050915-130050937 CTTGGGATCCAGGGCCCTGATGG + Intergenic
938329830 2:130441776-130441798 CTTGGGATCCAGGGCCCTGATGG + Intergenic
938360116 2:130679727-130679749 CTTGGGATCCAGGGCCCTGATGG - Intergenic
938436518 2:131286434-131286456 CTTGGGATCCAGGGCCCTGATGG - Intronic
942226156 2:173818061-173818083 CTTGGAAGGCATGGCATGGAAGG - Intergenic
943240424 2:185377132-185377154 CTTGAAACGCAGGGCCCTGGTGG + Intergenic
944672420 2:202006208-202006230 TTTGGAAAGCAGGGCAATGCCGG - Intergenic
945388988 2:209241057-209241079 CTTGTAAGGCTGGGCATTGAAGG + Intergenic
945870379 2:215220240-215220262 CTTGGAAGGAGGAGCCAAGATGG + Intergenic
946436985 2:219663716-219663738 CCAGGAAGGAAGAGCCATGAAGG - Intergenic
946643742 2:221811709-221811731 ATTAGAAGGCAGGCCCAGGATGG - Intergenic
947488943 2:230577543-230577565 CTTCCAAGGCTGGGCAATGAGGG - Intergenic
948009750 2:234642032-234642054 CTTGGGAGGCTGAGGCATGAGGG + Intergenic
948016199 2:234692760-234692782 GTTGGAAAGCAGGGCTATGCTGG + Intergenic
948019011 2:234715012-234715034 CTTGCAAGGAAGGGCCAAGAAGG + Intergenic
948790187 2:240372807-240372829 CACGGAGGGCAGGGCCATGGAGG + Intergenic
948826954 2:240577496-240577518 CTGGGAAGCCAGGGGCAGGAGGG + Intronic
1168996718 20:2138648-2138670 CTGGGGAGGCAGGTCCAGGAGGG + Intronic
1169068700 20:2708610-2708632 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1169288426 20:4328640-4328662 CTAGGAAGGCAGGGACATGCTGG - Intergenic
1169980493 20:11379231-11379253 CTTGGGGGGCAGGGCCAAGATGG + Intergenic
1170531328 20:17295655-17295677 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1171883571 20:30635328-30635350 CTTCGAAGACAGGGAGATGAGGG - Intergenic
1173318686 20:41968286-41968308 CTTGAAACCCAGGGCCCTGATGG + Intergenic
1174540589 20:51286201-51286223 CTTGGGAGACAGGACCAAGATGG + Intergenic
1175667527 20:60873081-60873103 CATGGAAGGCAGTGCCATGGGGG - Intergenic
1175792011 20:61745758-61745780 CTTGGAAGTCACAGGCATGATGG - Intronic
1176024211 20:62977587-62977609 CCTGGAAAGCAGGGCCCGGAGGG + Intergenic
1176305011 21:5118712-5118734 CTTGGCACCCAGGGCCTTGATGG + Exonic
1177382042 21:20356747-20356769 CTTGCAACGCAGAGCCATGAAGG - Intergenic
1177824607 21:26068465-26068487 CTTGGAAGGCTGAGACAGGAAGG - Intronic
1177948605 21:27505103-27505125 CTTGGAAGGCTGAGACAGGAGGG + Intergenic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
1179852044 21:44143318-44143340 CTTGGCACCCAGGGCCTTGATGG - Exonic
1179999236 21:44987612-44987634 CTTGGAAAAGAGGGCCAGGAGGG - Intergenic
1180616235 22:17129939-17129961 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1181162644 22:20967219-20967241 CTTGGAAGGCCGGGCAGGGAGGG - Intronic
1181670987 22:24425310-24425332 CTGGGAAGGCCGGGCCCTGTGGG + Intronic
1182353508 22:29711632-29711654 CCTGGTAGGCAGGGCCAGGTGGG - Intergenic
1182518087 22:30870244-30870266 CTGGGAAGGCTGGGCCAGGATGG + Intronic
1183410668 22:37653498-37653520 CCTGGTAGGTAGGGCCAGGATGG - Intronic
1184384284 22:44165504-44165526 GCTGTGAGGCAGGGCCATGAGGG + Intronic
1184740954 22:46428856-46428878 CTGGGGAGGCAGGGACATGCAGG - Intronic
949155952 3:827408-827430 CTGGGAAGGCACTGCCCTGAAGG + Intergenic
950465493 3:13150961-13150983 CTGGGATGACAGGGCCATGAGGG - Intergenic
950469867 3:13177836-13177858 CTGGGAAGGCAGGGGCCTGCAGG + Intergenic
950531453 3:13554371-13554393 CTGGGAATTCAGGGCCAGGATGG - Intronic
950641363 3:14350742-14350764 GTGGGATGGCAGGCCCATGAGGG + Intergenic
950886323 3:16366082-16366104 CAGGGAAGGCAGGGCAAAGAGGG + Intronic
951753908 3:26068063-26068085 CTTTGATGGCAGGGCCCTGGAGG - Intergenic
951951317 3:28202411-28202433 CTAGGAGGGCAGGGCCAAGATGG + Intergenic
952723246 3:36555361-36555383 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953163276 3:40441916-40441938 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953236855 3:41114432-41114454 TTTGGAAGGCAGAGACAGGAAGG + Intergenic
953853616 3:46484546-46484568 CTGGGAAGGCAGTGCCAAGAAGG + Intronic
954040214 3:47880571-47880593 CTTGGAAGGCTGAGGCATTAGGG - Intronic
954751706 3:52817726-52817748 CAGGGATGGCAGGGCCATGGCGG - Intronic
955728776 3:61961169-61961191 CCTGGAAGGAGGGGCCAGGAAGG + Intronic
957989568 3:87611927-87611949 CTAGGAAGGCAGGGCTAAGATGG + Intergenic
959075331 3:101743501-101743523 CTTGGAAGGCTGAGACAGGACGG - Intronic
960694887 3:120386387-120386409 CCTGGGAGGTTGGGCCATGAAGG + Intergenic
961508234 3:127385665-127385687 TCTAGCAGGCAGGGCCATGAAGG - Intergenic
961644886 3:128387668-128387690 ATTGGATGGCAGGGCCAGGCTGG + Intronic
962342513 3:134597212-134597234 CCTGGATGGCAGGGGCAAGAGGG + Intergenic
962389915 3:134962749-134962771 CTAGGAAGGCGGGGCTATGGAGG - Intronic
963136623 3:141911600-141911622 CTTGGAAGGCTGAGGCATGAGGG - Intronic
964637895 3:158877666-158877688 CGTTGAAGGCAGGGCCACCAAGG - Intergenic
965025464 3:163296776-163296798 CTTGAAACCCAGGGCCCTGATGG - Intergenic
965293226 3:166909999-166910021 CTTGGAATCCAGGGCCCTGTTGG + Intergenic
965483993 3:169256364-169256386 TTTAGAGGGCAGGGCCATTAAGG - Intronic
966212100 3:177463986-177464008 TTTGGAATGCAGAGTCATGATGG - Intergenic
966916049 3:184584581-184584603 CTTGGAAGGTGGGGCCTAGAGGG - Intronic
968226572 3:196976104-196976126 CCTGGCAGGCAGGGGCCTGAGGG - Intergenic
968534198 4:1113257-1113279 CTTGGGTGGGAGGGCCATGGGGG - Intronic
969178830 4:5421722-5421744 TTTTGAAAGCAGGGCCATGGAGG - Intronic
969542478 4:7801836-7801858 CTTGGGAGGCCGGGGCAGGAAGG + Intronic
969706869 4:8816596-8816618 CTTTGAAGGCAGGGTCATGCTGG + Intergenic
969728332 4:8938982-8939004 GATGGAAGGCAGGGCCCGGACGG + Intergenic
969783052 4:9426098-9426120 CTTGAAAGGCAGGCCTCTGAAGG - Intergenic
970724405 4:19027072-19027094 CTTGGAATGCAGGGACATTATGG + Intergenic
971137529 4:23886167-23886189 CTTGGAAGGCAGGGCCATGAGGG - Intronic
971709829 4:30096614-30096636 CTTAGAATTCAGGGCTATGACGG - Intergenic
972260983 4:37408060-37408082 CTTGAAACCCAGGGCCCTGATGG - Intronic
973367223 4:49217596-49217618 CTTTGAAGACAGGGAGATGAGGG - Intergenic
974264022 4:59560712-59560734 CTTGAAACGCAGGGCCCTGGTGG + Intergenic
979226522 4:118292126-118292148 GTTGGAAGGTAGGATCATGATGG - Intronic
981221996 4:142248024-142248046 CCTGGAGGGCAGGGGCAGGAGGG - Intronic
981296617 4:143140402-143140424 CTTGAAACCCAGGGCCCTGATGG - Intergenic
981352706 4:143751746-143751768 TTTGGAGGGTAGGGCCAAGACGG + Intergenic
981390979 4:144191157-144191179 ATTGCAAGTCATGGCCATGAAGG - Intergenic
981628301 4:146787011-146787033 CTTGGGAGGCTGGGGCAGGAGGG + Intronic
981740533 4:147996740-147996762 ATTTGAAGGCAGGGTCTTGAAGG + Intronic
981748605 4:148073150-148073172 CCTGGAAGGCAGAGGCATGCTGG - Intergenic
981789674 4:148522010-148522032 CTTGAAACCCAGGGCCCTGATGG + Intergenic
982735515 4:159002860-159002882 TTTGAAAGGCAGTGCTATGATGG + Intronic
984749245 4:183256040-183256062 CATGGGAGACAGGGCCATGGAGG - Intronic
984902901 4:184600728-184600750 CTTGAAACGCAGGGCCCTGGTGG - Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
986274868 5:6265061-6265083 CATGGAAGGCATGGCAATCATGG + Intergenic
986378875 5:7162908-7162930 CTTGAAACCCAGGGCCATGGTGG + Intergenic
986475069 5:8121264-8121286 CTTGGAAGACGGAGCCATGAGGG + Intergenic
987158962 5:15120326-15120348 CTTGGAAGGTTTGGCCATGCTGG + Intergenic
987286755 5:16465240-16465262 CATGGACGGCTGGGCCTTGATGG + Exonic
987710316 5:21495860-21495882 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
988490365 5:31700558-31700580 CTTAGCAGGCAGGGCCTTGCAGG - Intronic
991026717 5:62037762-62037784 CTTGAAAGCCAGGGCCCTGGTGG + Intergenic
991737550 5:69641509-69641531 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991760644 5:69914916-69914938 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991786688 5:70203185-70203207 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991789126 5:70221235-70221257 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991813876 5:70496341-70496363 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991817007 5:70517625-70517647 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991839875 5:70789966-70789988 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991879133 5:71203570-71203592 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991881573 5:71221599-71221621 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
994378029 5:99037642-99037664 CTTGAAACCCAGGGCCCTGATGG - Intergenic
994422269 5:99535961-99535983 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
995919030 5:117288458-117288480 TTAGGAAGGCAGGGTCAGGAAGG - Intergenic
996638935 5:125729832-125729854 CTCGCCAGGCAGGGCCAAGATGG + Intergenic
997431300 5:133842973-133842995 CTTGGAAGTCAGGGCCTGCAGGG - Intergenic
997902394 5:137778746-137778768 ATGGTAAGGCAGGGCAATGAAGG + Intergenic
997975359 5:138438896-138438918 CGAGGAAGGCAGGGCACTGAGGG + Intergenic
998875138 5:146591417-146591439 CTTGTCAGGCAGGGCGCTGAGGG + Intronic
999394015 5:151215077-151215099 CCTGGCAGGCAGGACCCTGAAGG + Intronic
1000039080 5:157471782-157471804 CTTGGAAGCCATCTCCATGATGG - Exonic
1001362715 5:171103707-171103729 CTTGAAACGCAGGGCCCTGGTGG + Intronic
1001541803 5:172545052-172545074 CGTGGAAGGCAGGGCCCTTCTGG + Intergenic
1001543991 5:172558725-172558747 CTGGGAAGGCAGGGCTCGGAAGG + Intergenic
1002968299 6:1989782-1989804 CAGGGAAGGCAGGGCCAGGCTGG - Intronic
1004289435 6:14352790-14352812 CTTGGAAGGCAGGCCCACTGGGG - Intergenic
1004343995 6:14831487-14831509 CTTGGAGGGCAGGACCATCGTGG + Intergenic
1005547374 6:26884650-26884672 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1005937018 6:30530894-30530916 CTTGGGAGGCTGGGCCAGGGAGG - Intergenic
1006196191 6:32243954-32243976 CTTGGAGGGCAGGGCATTGGGGG - Intergenic
1007132042 6:39484422-39484444 CTAGGAATGCAGGGCCAGGAAGG + Intronic
1008457651 6:51729156-51729178 CTTGAAAGTCATTGCCATGAAGG - Intronic
1009018134 6:57925722-57925744 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1010486067 6:76416182-76416204 CTTGGAGGGCAGGGAGATGAAGG - Intergenic
1012780170 6:103547536-103547558 CTTGGAAGACAGGAAGATGAGGG - Intergenic
1013969223 6:115996595-115996617 CTTAGAAGTCTGGGCCATGTAGG - Intronic
1016822527 6:148360142-148360164 CATGGAATGCAGAGCCATGTAGG - Intronic
1016847361 6:148581549-148581571 ATTGGAAGCCAGTGCCAGGAAGG - Intergenic
1017871842 6:158493550-158493572 CTGGGGAGGCAAGGCCAGGAGGG - Intronic
1018435763 6:163757554-163757576 AAAAGAAGGCAGGGCCATGAGGG - Intergenic
1018853893 6:167662194-167662216 CGTGGAGGGCGGGGGCATGAAGG + Intergenic
1020342721 7:7130144-7130166 CTTGGTAAGCAGGACCATGCAGG + Intergenic
1020519627 7:9169498-9169520 CTTGAAAGCCAGGGCCCTGGTGG + Intergenic
1022766051 7:33413592-33413614 CTTGTAAGACAAGACCATGAAGG - Intronic
1023205556 7:37745642-37745664 CTTGGAAGACAGGGCAATGGAGG + Intronic
1024096464 7:45986653-45986675 CATAGAAGGCAGGCCCAGGATGG + Intergenic
1024960502 7:54969834-54969856 CGTGGAAGGAGGGGACATGAGGG + Intergenic
1026362936 7:69619384-69619406 CTTGGAAGTCAGGGGGATGCAGG + Intronic
1026688285 7:72531428-72531450 AATGGAAGGCAGTGCAATGAGGG - Intergenic
1026898824 7:74026217-74026239 TTTGGAAGGTAGGGGCATGCTGG - Intergenic
1028144253 7:87304391-87304413 CTTGAAACCCAGGGCCATGTTGG - Intergenic
1031669510 7:124525583-124525605 CCTCTATGGCAGGGCCATGAAGG + Intergenic
1032524479 7:132569241-132569263 CTGGGAAGGCAGGGCCAGCTTGG + Intronic
1032794764 7:135268769-135268791 ATGGGGAGGCAGGGCTATGAAGG - Intergenic
1032825711 7:135565853-135565875 CTTGGATTCCAGGGCCATGATGG - Intronic
1032996883 7:137456711-137456733 CTTGGAACTCATGGCAATGAAGG + Intronic
1033117166 7:138635478-138635500 TTTGGAAGGCTGGGGCAGGAGGG - Intronic
1034558915 7:151867228-151867250 CTTTGAGGGCAGGGCCCTGTTGG + Intronic
1034715152 7:153235101-153235123 CTTGAAACCCAGGGCCCTGATGG + Intergenic
1036655841 8:10676753-10676775 GTGGGGAGGCAGGGCCTTGAGGG - Intronic
1036836009 8:12067960-12067982 CTTGAAAGGCAGGCCTCTGAAGG + Intronic
1036857852 8:12314530-12314552 CTTGAAAGGCAGGCCTCTGAAGG + Intergenic
1038619421 8:29125998-29126020 CTTGGTAGGCTGGGGCAGGAGGG + Intronic
1039217566 8:35289874-35289896 CTTGGAAGGCTGAGACAGGAGGG + Intronic
1039450668 8:37672500-37672522 TTTGGAAGTCAGGGGCATGGTGG - Intergenic
1039740245 8:40376316-40376338 CTTGGAAGGCAAGTGCAGGATGG - Intergenic
1040567425 8:48580495-48580517 CATGACAGGCATGGCCATGATGG + Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1040637261 8:49289815-49289837 GCTGGAAGGCAGGAGCATGACGG - Intergenic
1041557683 8:59176178-59176200 CTTGGAAGGAAGGTCAAAGAAGG + Intergenic
1042824662 8:72967893-72967915 TTTGGAAGGCAAAGCCAGGAGGG + Intergenic
1043570918 8:81601425-81601447 CTTTGAAGTCAGGGATATGAAGG + Intergenic
1044131052 8:88525222-88525244 CTTGAAACCCAGGGCCATGGTGG - Intergenic
1044849066 8:96409948-96409970 GTTGGGAGGCAGGGCCATAGAGG - Intergenic
1046828052 8:118713679-118713701 CTTGGTAGGCCCAGCCATGAAGG - Intergenic
1048460071 8:134614224-134614246 CTTGCAAGTCATGGCCTTGATGG - Intronic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048645206 8:136412159-136412181 CTTGGAGGTCATGGCCATGAAGG + Intergenic
1048880796 8:138871027-138871049 CCTGGAAGGCATGGTCACGAGGG + Intronic
1049540906 8:143208344-143208366 CCTGGAAGGCAGGAACTTGATGG - Intergenic
1050328872 9:4524945-4524967 ATTGGAAGGCAGGGCCCAGTGGG - Intronic
1050577441 9:7011905-7011927 CATGGAAGGCAGAGCAGTGAAGG - Intronic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1052052139 9:23860539-23860561 CTTGGAAGACAGGGCAATGCAGG + Intergenic
1052628225 9:31004446-31004468 TTTGGGGGGCAGGGCCAAGATGG + Intergenic
1052840418 9:33288310-33288332 CTTGGAAGGCAGGGTGGTGTTGG + Intergenic
1053553011 9:39103849-39103871 CGTGGAAAGCAGGGAAATGAAGG + Exonic
1053817131 9:41924028-41924050 CGTGGAAAGCAGGGAAATGAAGG + Exonic
1054107384 9:61067678-61067700 CGTGGAAAGCAGGGAAATGAAGG + Intergenic
1054613473 9:67263447-67263469 CGTGGAAAGCAGGGAAATGAAGG - Intergenic
1054904099 9:70399794-70399816 TTTGGAAGGAAGGGCCTGGAAGG - Intronic
1056376864 9:86023151-86023173 CTTGGAAAGGAGAGCCAAGAGGG - Intergenic
1056853167 9:90101743-90101765 TTTGGGAGGCAGGCCCAGGAGGG - Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057867298 9:98691714-98691736 CTTGGAAGGTAGGACTTTGAGGG - Intronic
1058607735 9:106741722-106741744 CCTGGAGGTCAGTGCCATGAAGG + Intergenic
1059234596 9:112751015-112751037 CGTGGACGGCAGGGCCTTGGGGG - Exonic
1061591907 9:131603246-131603268 CCTTGAAGGGAGGCCCATGAGGG - Intronic
1062338420 9:136082648-136082670 CTTGGGAGGCAGGTCCGTGGAGG - Intronic
1186925239 X:14326392-14326414 CTTGCAAGGCAAGGACATTAAGG + Intergenic
1188057627 X:25560019-25560041 CATGGAATGCAGGGACATCAGGG + Intergenic
1189251137 X:39601446-39601468 CCTGGATGGCATTGCCATGATGG + Intergenic
1190717069 X:53114004-53114026 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1191138869 X:57094671-57094693 CGTGAAACGCAGGGCCCTGATGG - Intergenic
1191969625 X:66799071-66799093 CTTGAAACCCAGGGCCCTGATGG - Intergenic
1191987267 X:66995253-66995275 CTTGAAACCCAGGGCCCTGATGG + Intergenic
1192712655 X:73607590-73607612 CTTGAAACCCAGGGCCATGGTGG + Intronic
1192723943 X:73728280-73728302 TTTGGAAGGCAGGGACATGCAGG - Intergenic
1193065331 X:77253755-77253777 CTAGAAAGGAAGGGCCAAGATGG + Intergenic
1193897224 X:87128640-87128662 CTTGAAACCCAGGGCCCTGATGG - Intergenic
1194445031 X:93976349-93976371 CTTGGGACGCAAGGCCCTGATGG + Intergenic
1194778290 X:97992133-97992155 CTTGGAAGACAGGAACATGTGGG - Intergenic
1195985533 X:110626345-110626367 CTTGAAACCCAGGGCCCTGATGG - Intergenic
1199658400 X:150021833-150021855 CTCAGAAGGGAGGGCCATGCTGG + Intergenic
1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG + Intergenic
1200954953 Y:8934845-8934867 CTTGGATGTCAGTGCCTTGAAGG - Intergenic
1202183814 Y:22162727-22162749 CTTGGATGTCAGTGCCTTGAAGG + Intergenic
1202207545 Y:22423674-22423696 CTTGGATGTCAGTGCCTTGAAGG - Intergenic
1202263917 Y:22998311-22998333 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202416908 Y:24632053-24632075 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202453879 Y:25038033-25038055 CTTTGAAGGCAGAGCCACGATGG + Exonic