ID: 971137824

View in Genome Browser
Species Human (GRCh38)
Location 4:23889040-23889062
Sequence TAATCTCTGGAGTCTAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971137824 Original CRISPR TAATCTCTGGAGTCTAGTGG GGG (reversed) Intronic
900329737 1:2128059-2128081 GAAGCTCCGGAGTCTAGAGGTGG + Intronic
902136944 1:14315480-14315502 TTATGTCTTGATTCTAGTGGTGG - Intergenic
907515200 1:54989461-54989483 CAATCTTTGGAGTCTGGTTGGGG - Intronic
908792185 1:67793912-67793934 TATTTTCTGGAGTCAAGTGGTGG - Intronic
910645755 1:89513461-89513483 GAAACTCTGGAGTCTATTGAAGG - Intergenic
912883480 1:113444028-113444050 GGATCTCTGGAGTCTACTGAAGG + Intronic
913303053 1:117393908-117393930 GAATGTGTGGAGTCTAGTGATGG + Intronic
918202350 1:182279311-182279333 TCAGCTCTGGTGTCTACTGGTGG - Intergenic
919295640 1:195696503-195696525 TTATCTCTGGAGGCTTTTGGGGG - Intergenic
921538441 1:216382173-216382195 AAAGTTCTGGAGTCTAGTGATGG + Intronic
922208943 1:223472319-223472341 AATTCTCTGGAGTCCAGGGGTGG - Intergenic
923527356 1:234782891-234782913 GAATCTCTGGAGACGACTGGTGG + Intergenic
1065333659 10:24631471-24631493 TAATCTCTTGACTGTATTGGGGG - Intronic
1065583230 10:27192543-27192565 GAATCACTGGATTCTCGTGGAGG + Intergenic
1067014743 10:42749556-42749578 TCAAGTCTGGAGGCTAGTGGTGG - Intergenic
1069168744 10:65198223-65198245 TAATCTCAGGAGTATCCTGGAGG + Intergenic
1072747884 10:97954338-97954360 TTATCTGTGGAGTCTAATGATGG - Intronic
1073112573 10:101071295-101071317 TAATCTCTGAAGGGTAATGGTGG + Intergenic
1074806373 10:117057187-117057209 TCAACTCTGGAGTCTATTGAAGG + Intronic
1077395652 11:2319837-2319859 GACTCTCTGCAGTCTTGTGGTGG + Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1081286898 11:41281801-41281823 TAGTTTGTGGAGTTTAGTGGAGG + Intronic
1082204974 11:49422201-49422223 TAGTATTTGGAGTCTAGTGGTGG + Intergenic
1083044553 11:59722058-59722080 TAAAATCTGGAGTCTGGGGGAGG + Intronic
1086024512 11:82274004-82274026 TAATCACTTGAGACTTGTGGTGG - Intergenic
1086650118 11:89278341-89278363 TAGTATTTGGAGTCTAGTGGTGG - Intronic
1089303139 11:117510716-117510738 TAGTGCCTGGAATCTAGTGGAGG + Intronic
1091089076 11:132752538-132752560 TTTTCTCTGGATTTTAGTGGGGG - Intronic
1091403180 12:193218-193240 TCATCTCTGGAGTCTTCTGGGGG + Intronic
1091706693 12:2698556-2698578 GAAACTCTGGAGTCTAATGAAGG + Intergenic
1092730290 12:11525955-11525977 GAATATCTGGAGTCTAGGGCGGG - Intergenic
1094795343 12:33965532-33965554 TAATCTCTGGAGCAAAGTGATGG + Intergenic
1095107982 12:38258636-38258658 TAATCTCTGGAGCAAAGTGATGG + Intergenic
1096798634 12:54094501-54094523 TTACCTCTGGAATCTGGTGGAGG - Intergenic
1096951085 12:55472154-55472176 AAATCTTTGGAGACTGGTGGGGG + Intergenic
1097035599 12:56121627-56121649 TGATCTCTGGGGTCAAGTGTGGG - Exonic
1097272252 12:57783248-57783270 AAAGCTCTGGAGACTTGTGGCGG + Exonic
1097810463 12:64013437-64013459 CAATCTTTGAAGGCTAGTGGTGG + Intronic
1100780026 12:98013998-98014020 TAATCTTTGTAGTCTTGTGTTGG - Intergenic
1104519789 12:129462974-129462996 AAATCTCTGGAGTTTATTGTGGG - Intronic
1107474120 13:40718373-40718395 TATACTCTGGTGTCTAGTAGAGG + Intergenic
1108306392 13:49139278-49139300 TTATCACTGGAGTATAGTGAAGG + Intronic
1108564657 13:51683816-51683838 TAGTCTCTGGGGTTTAGTGCTGG + Intronic
1109050395 13:57473619-57473641 GAATCTCTGGAGGGTGGTGGGGG - Intergenic
1114038351 14:18650994-18651016 AACTCTCTGAAGTGTAGTGGAGG + Intergenic
1114070670 14:19103210-19103232 TCAAGTCTGGAGGCTAGTGGTGG + Intergenic
1114091591 14:19296796-19296818 TCAAGTCTGGAGGCTAGTGGTGG - Intergenic
1116659548 14:47691814-47691836 CAATCTCTTGACTTTAGTGGAGG + Intergenic
1121447063 14:93985676-93985698 TAATCTCAGGACTCTGGGGGAGG - Intergenic
1122554682 14:102571419-102571441 GAAACTCTGGAGTCTACTGAAGG - Intergenic
1124588702 15:31034654-31034676 TTATCTCTGGACTCTTGTGCAGG - Intronic
1133847023 16:9464594-9464616 TACTCTATGGACTCTAGTGAAGG + Intergenic
1133999975 16:10775336-10775358 TGATATTTGGAGTCAAGTGGCGG - Intronic
1137923191 16:52512383-52512405 TTATCTCTGGAGTCAAGTTCTGG - Intronic
1139549886 16:67667286-67667308 TCATCTCTAGTGTCCAGTGGCGG + Exonic
1140932870 16:79643990-79644012 TCATCTCTGGGGTCTTTTGGGGG + Intergenic
1141441765 16:84033807-84033829 TAGTATCTGGAGTCAAATGGGGG + Intronic
1149099431 17:52885941-52885963 TAATCTCCTGAGTCTTTTGGGGG + Intronic
1152465164 17:80462174-80462196 TAAGGTCTGGACTCCAGTGGTGG - Intergenic
1153873470 18:9343098-9343120 TAAACTGTTGAGTCTAGTGTTGG + Intronic
1155020864 18:21896148-21896170 CATTCTCTGGAGTCCAGTGGCGG + Intergenic
1159714650 18:71806491-71806513 TAGACACTGGAGACTAGTGGAGG + Intergenic
1160569275 18:79805805-79805827 TAAAATCTAGAGTCTAGTTGTGG + Intergenic
1162869045 19:13571947-13571969 TAAGGCCTGGAGTCTGGTGGTGG - Intronic
1165839772 19:38781358-38781380 TAATCTCTGTAAACTAGCGGAGG - Intergenic
1166006469 19:39911061-39911083 TGATCTCTGCAGTCTGTTGGAGG - Intronic
925529040 2:4839151-4839173 TAATGTCTGGTGTCCAGAGGAGG + Intergenic
930343943 2:50154051-50154073 TAATCTCTGGAGTCTATTAAAGG - Intronic
934917723 2:98313756-98313778 CAATCACTGGTGTCTGGTGGTGG + Intergenic
1169423563 20:5478634-5478656 GAATCTCAGGAGTCAATTGGTGG - Intergenic
1170997808 20:21381188-21381210 TGGTCTCGGGAGTCTAGAGGAGG + Intronic
1173243596 20:41318456-41318478 TAATCACTGGATTCTAAAGGTGG - Intergenic
1180489136 22:15825675-15825697 TCAAGTCTGGAGGCTAGTGGTGG + Intergenic
1182074752 22:27488045-27488067 TAATCTCCGGGGTCCAGTGAGGG - Intergenic
949479463 3:4479837-4479859 GAACCTCTGCAGTCTGGTGGTGG + Intergenic
951624745 3:24646744-24646766 TAATCTGTGGGGTTTGGTGGAGG + Intergenic
951970341 3:28437936-28437958 TGAACTCTGGAGTCTATTGAAGG + Intronic
956310616 3:67875240-67875262 TATCCTCATGAGTCTAGTGGGGG - Intergenic
957794943 3:84992136-84992158 TAAACTATGGACTCTGGTGGAGG + Intronic
968217577 3:196906390-196906412 CAAAGTCTGCAGTCTAGTGGTGG + Intronic
969968929 4:11026330-11026352 CAAGCTCTGGAGTATAGTGAGGG + Intergenic
971137824 4:23889040-23889062 TAATCTCTGGAGTCTAGTGGGGG - Intronic
975461041 4:74653304-74653326 AAATCTCTGTAGTCTTGAGGAGG - Intergenic
983461335 4:168028642-168028664 TAAGTTCTGGTTTCTAGTGGAGG + Intergenic
986594170 5:9403412-9403434 TAAACTCGGGTGCCTAGTGGAGG - Intronic
990293161 5:54375445-54375467 GAAGCTCTGGAGTCTATTGAAGG - Intergenic
995822148 5:116247793-116247815 CAAACTCTGGGGTCTATTGGAGG + Intronic
995910691 5:117183158-117183180 TAATCTTTGGATTCTAGATGTGG + Intergenic
998599747 5:143573383-143573405 ACATCTCTGAAGGCTAGTGGTGG + Intergenic
1000173730 5:158729307-158729329 TGATCTCTAGAGTCCACTGGAGG - Intronic
1005447464 6:25939446-25939468 TGATCTCTGGAGTCTGGTTTAGG - Intergenic
1006690332 6:35878458-35878480 GAAACTCTGGAGTCTACTGAGGG + Intronic
1010044570 6:71426251-71426273 TAATCTCTGGGATCCAGAGGAGG - Intergenic
1010111849 6:72245846-72245868 TACTCACTGGACTCCAGTGGAGG - Exonic
1012386300 6:98687386-98687408 TAGACTCTGGAGACTAGTTGAGG + Intergenic
1012553889 6:100489431-100489453 GAATCTCAGCAGTCTTGTGGTGG - Intergenic
1012558743 6:100551269-100551291 GAAGCTCTGCAGTCTAGCGGGGG + Intronic
1015445886 6:133304327-133304349 GATTCTCTGGAGTCTAGAGGAGG + Intronic
1016428321 6:143957282-143957304 GACTCTCAGGAGTCTGGTGGGGG + Intronic
1018987363 6:168648216-168648238 GAATCTCTGGAGGCCAGTGGAGG + Intronic
1019061403 6:169260409-169260431 TCATCCCTGGAGTGGAGTGGAGG + Intergenic
1019657589 7:2204470-2204492 TGATCCCTGGAGTCTCGTGCTGG - Intronic
1019845579 7:3496773-3496795 TAATCAATTTAGTCTAGTGGAGG + Intronic
1019944542 7:4316207-4316229 TATTCTCTGCAGTTTAGGGGTGG + Intergenic
1024746917 7:52418372-52418394 TAATATCTGGGGTATGGTGGAGG + Intergenic
1039211892 8:35226533-35226555 TTATCTGTGTGGTCTAGTGGAGG + Intergenic
1040506034 8:48048956-48048978 TAATCTCTTGAGTCAAGGTGAGG + Intronic
1044325807 8:90856080-90856102 CAAGCTCTGCAGTCTAGGGGTGG - Intronic
1046625773 8:116575512-116575534 TAATCTCTGGAGGCAACTGAGGG + Intergenic
1047881155 8:129195064-129195086 TAATTTCTGGACTCTACTGATGG - Intergenic
1049975259 9:855543-855565 TATTCTCTGGTGTCTACAGGTGG - Intronic
1053788244 9:41667613-41667635 TTACCTCTGGAATCTGGTGGAGG - Intergenic
1054156895 9:61647155-61647177 TTACCTCTGGAATCTGGTGGAGG + Intergenic
1054176526 9:61878952-61878974 TTACCTCTGGAATCTGGTGGAGG - Intergenic
1054476667 9:65578163-65578185 TTACCTCTGGAATCTGGTGGAGG + Intergenic
1054661009 9:67701854-67701876 TTACCTCTGGAATCTGGTGGAGG + Intergenic
1058174349 9:101720829-101720851 TAGACTCTGGAGCCTACTGGAGG + Intronic
1186008651 X:5104507-5104529 TATTCCCTGGTGTCTAGGGGAGG + Intergenic
1187246259 X:17555290-17555312 TCATCACTGCAGTCTAGTGAGGG - Intronic
1188603118 X:31994061-31994083 TAGTTTATGGAGTCTTGTGGAGG - Intronic
1188861521 X:35262337-35262359 TAATATTTGGAGTCTAGAAGGGG - Intergenic
1189171512 X:38914014-38914036 CAACATCTGGAGTCTAGTAGTGG + Intergenic
1189870072 X:45371935-45371957 TACTCTCTGAAGGCTTGTGGTGG + Intergenic
1191794753 X:65009366-65009388 CAAACTCTGGAGTCTATTGAAGG - Intronic