ID: 971138170

View in Genome Browser
Species Human (GRCh38)
Location 4:23892995-23893017
Sequence TTTCTATTGTTGAGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 740}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971138170 Original CRISPR TTTCTATTGTTGAGAAAAAA TGG (reversed) Intronic
900157632 1:1209660-1209682 TTTCTATTTTTCATAGAAAAGGG + Intergenic
901274793 1:7982795-7982817 TAACTATTGTAGAGAAAAAGAGG - Intronic
901724735 1:11232185-11232207 TTTCTTTTGTATAGACAAAATGG + Intronic
901822820 1:11841153-11841175 TTTCTACTTTGGAAAAAAAATGG - Exonic
902143235 1:14374539-14374561 TTTTCATTGGTGAAAAAAAAGGG - Intergenic
904149868 1:28429362-28429384 TTGCTTTTGTGGGGAAAAAATGG - Intronic
905734104 1:40314540-40314562 TTTTTATTTTTGAGGAAAAGGGG - Intronic
905847419 1:41243907-41243929 TCTCTGTTGATGAGATAAAAGGG - Intergenic
906880928 1:49589181-49589203 TTAATATTGTTGAGTATAAATGG + Intronic
907679491 1:56550382-56550404 TTTCAGCTGTTGAGAGAAAAGGG + Intronic
907938317 1:59062734-59062756 TTTCTTTTATTGAGAAACTATGG - Intergenic
907970414 1:59375415-59375437 TTTCTTTTGTAGAGAAAGCAGGG + Intronic
908303086 1:62782126-62782148 TTTTAATTGGTTAGAAAAAAAGG - Intergenic
908613418 1:65888467-65888489 TTTCTATTTATGTGAAAAAATGG + Intronic
908856787 1:68439052-68439074 TTCATATTGCTGACAAAAAAAGG - Exonic
908973579 1:69868235-69868257 TTTCTATTATTTAAATAAAATGG + Intronic
909569920 1:77097758-77097780 TTACAATTATTGAGAATAAAGGG + Intronic
909694034 1:78444405-78444427 TTTCCAGAGTTGAGAACAAAGGG + Intronic
909711822 1:78660111-78660133 TTGCTAGTGTTGTGAAATAAGGG + Intronic
910226462 1:84941092-84941114 TGTCTATTGTTAAAACAAAATGG + Intronic
910299046 1:85684700-85684722 TTTCTATTTTTGTAAACAAATGG - Intronic
910608159 1:89110065-89110087 TTATTATTGTAGAGAAAGAATGG - Intronic
910929424 1:92428145-92428167 TTTCAATTCTTTAAAAAAAATGG + Intergenic
910986004 1:93005506-93005528 TTGGTATTGCAGAGAAAAAAAGG + Intergenic
911312470 1:96310962-96310984 TTTTTAATTTTGAGGAAAAAAGG + Intergenic
911820857 1:102418888-102418910 TTTTTAATGTGGAGAAAAATTGG - Intergenic
911944567 1:104090740-104090762 TTTTCATTATTGAAAAAAAAAGG + Intergenic
912832811 1:112968799-112968821 TTTCTATTTTTTAGTAAAGACGG - Intergenic
913359427 1:117963534-117963556 TTTCTATTGTTTAGTAGAGACGG + Exonic
913413962 1:118584231-118584253 TTCCTGTTTTTGAGAAAATAAGG + Intergenic
914443678 1:147730376-147730398 TTTCTATTTCTATGAAAAAATGG + Intergenic
915211266 1:154311374-154311396 TTTATATTTTTTAGTAAAAATGG - Intergenic
915924905 1:160009661-160009683 TTTCTAGGGTAGAGGAAAAATGG - Intergenic
916550618 1:165846436-165846458 TTTGTTTTGTTTAAAAAAAAGGG - Intronic
916571385 1:166030899-166030921 ATCTTATTGTTGAGAAAGAAAGG + Intergenic
916967958 1:169972759-169972781 TTTCATTTGTTTAGAAAAACAGG + Intronic
917858652 1:179123634-179123656 TATGTATTTTTGAGAAATAAGGG + Intronic
918087688 1:181259476-181259498 TTTGTATTGACGAGAAGAAAGGG - Intergenic
918304814 1:183236217-183236239 TTGCTTTTGTTAAAAAAAAAGGG + Intronic
918974294 1:191462116-191462138 TCTCTATAGTTTGGAAAAAAAGG + Intergenic
918997956 1:191786856-191786878 TTTTTATTTTTCAGTAAAAAGGG + Intergenic
919168599 1:193926868-193926890 TTTCTGTTGTTGAGACTACATGG + Intergenic
919185260 1:194138245-194138267 TTTATATTTTTAAGATAAAAAGG + Intergenic
919261059 1:195194676-195194698 TTTTTTAAGTTGAGAAAAAAAGG - Intergenic
919307286 1:195857737-195857759 ATTCTATTATTTAGAAATAAAGG + Intergenic
919411233 1:197245870-197245892 TTTTTCTTGATGAGAGAAAAAGG + Intergenic
920697506 1:208192444-208192466 TTTTTGTTGTTTAAAAAAAAAGG - Intronic
921299333 1:213735641-213735663 TTTCTCTTGTTCAGATAAGATGG - Intergenic
921327650 1:214002814-214002836 TTTATTTTGAGGAGAAAAAAAGG + Intronic
921434148 1:215097418-215097440 TTTTTTTTTTTAAGAAAAAAAGG - Intronic
921788030 1:219256105-219256127 CTTCTATAGTAGAGGAAAAAAGG - Intergenic
922145627 1:222941032-222941054 TTTCTTTTGTTAACAACAAAAGG + Intronic
922814575 1:228439364-228439386 AATCCATTGTTGAGAAACAACGG + Intergenic
923403179 1:233635460-233635482 TTTGAATTGTTGAGTAAAAATGG + Intronic
923428753 1:233898852-233898874 TTTCTATTTATGTAAAAAAATGG + Intergenic
923548909 1:234945838-234945860 TTTGTATTTTTTAGAAGAAATGG - Intergenic
923572067 1:235125385-235125407 TTTCTATTTTTTAGTAAAGACGG + Intronic
923754823 1:236782596-236782618 TTTTTATTGTTTATAAAAATGGG + Intergenic
923916128 1:238507462-238507484 TTTATATTGTTGATAAAATCAGG + Intergenic
924047669 1:240048966-240048988 TTTATAATGTTGAGATATAAAGG - Intronic
924617217 1:245622346-245622368 TATCTAGTACTGAGAAAAAAAGG - Intronic
1062979213 10:1707937-1707959 TTTTTCATGATGAGAAAAAATGG - Intronic
1063023785 10:2157070-2157092 TTTCTATTATTAATAAAAATTGG + Intergenic
1063123712 10:3122754-3122776 CTTCTATTGTTCAGAAAATTTGG + Intronic
1064201929 10:13292144-13292166 TGTTTCTTGTAGAGAAAAAATGG - Intronic
1064696130 10:17967136-17967158 TTTTTTTTGTTGAAAAACAAAGG + Intronic
1064917883 10:20482054-20482076 TTTCTATTTCTGTGAAAAAATGG + Intergenic
1065377922 10:25061487-25061509 TTTCTATTTTCAGGAAAAAAAGG + Intronic
1065444065 10:25779623-25779645 TTTCTGTTTTTGAGATAAGACGG + Intergenic
1068040213 10:51814765-51814787 TTTCTTTTTTTAATAAAAAATGG - Intronic
1068068978 10:52171432-52171454 TTTTTATTGCTGAGAAAATGGGG - Intronic
1068430579 10:56926743-56926765 TGTCTCTTGTTGGGTAAAAATGG + Intergenic
1068568402 10:58601023-58601045 TATCCATTTGTGAGAAAAAAAGG - Intronic
1068572605 10:58646931-58646953 TTTCTGTTTTTAAGTAAAAATGG + Intronic
1070109662 10:73472695-73472717 CTTTTATTTTTCAGAAAAAATGG - Intronic
1070318704 10:75338093-75338115 TTTCTATTCTTAAGAAACACTGG - Intergenic
1070758471 10:79008334-79008356 ATCCTATGGTTGAGAGAAAAAGG + Intergenic
1071058188 10:81535559-81535581 TTTTTATTTGTGAGAGAAAAGGG - Intergenic
1071172378 10:82881557-82881579 TTTCTATTTCTGTGAGAAAAAGG + Intronic
1071876352 10:89847520-89847542 TTTCTATTACTGACAAATAATGG - Intergenic
1071960104 10:90801841-90801863 TTTTGATTATTGGGAAAAAAGGG + Intronic
1072290076 10:93956520-93956542 TTTATATAGTTGGAAAAAAAAGG + Intergenic
1072354183 10:94589857-94589879 TTTCTATTTTTGAGTAGAGACGG + Intronic
1073747659 10:106487981-106488003 TTTTTCTTGTTTAGAAGAAAGGG + Intergenic
1074393785 10:113079963-113079985 CTTTTATTGGTGAGAAGAAAAGG + Intronic
1074838122 10:117319735-117319757 TTTTTATTGCTGAAGAAAAAAGG + Intronic
1075609998 10:123845528-123845550 TTTCTATTTTTAAAACAAAAAGG + Intronic
1078233379 11:9462019-9462041 TTCCTGTAGTTGACAAAAAACGG + Intronic
1078681154 11:13477413-13477435 TTTCTCTTCTTGAGAAATTATGG + Intergenic
1078792572 11:14559316-14559338 TTTCTAATCATGAGAGAAAAGGG + Intronic
1079067707 11:17311625-17311647 TTTATATTTTTGGAAAAAAATGG + Intronic
1079975309 11:27083740-27083762 CTTCTCTTGTTGGGGAAAAAGGG - Intronic
1080212579 11:29804093-29804115 TTTCTACTCTTGAGAGAAAATGG - Intergenic
1080261326 11:30352656-30352678 TTTATATTGATGAGATGAAATGG - Intergenic
1080432674 11:32213103-32213125 TTGCAATTTTTGAGACAAAAAGG - Intergenic
1080545251 11:33310739-33310761 TTTCCGTTGTTGCGAAAATACGG + Intronic
1080622849 11:34001616-34001638 TTTCTGTTGTGGAATAAAAATGG + Intergenic
1080688242 11:34533748-34533770 TTCCTCATGTGGAGAAAAAAGGG + Intergenic
1080814542 11:35741555-35741577 TTTATAATGCTAAGAAAAAAGGG + Intronic
1081260700 11:40956752-40956774 TTTATATTGATGAGAGAAAGAGG - Intronic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1082833301 11:57635282-57635304 TTTCTATTTTTGAAAAAACAAGG + Intergenic
1082928082 11:58572287-58572309 TTTCATTTGTTAAAAAAAAAAGG - Intronic
1083095350 11:60244809-60244831 TTTCTATTCTCTAGCAAAAAGGG - Intergenic
1084639544 11:70416601-70416623 TTTCTATTTTTTAGTAAAGATGG + Intronic
1085916586 11:80895836-80895858 TTTCTAGTGTTGCATAAAAATGG + Intergenic
1085916810 11:80899854-80899876 TTTTTATTGTTGAGATATAACGG + Intergenic
1086250827 11:84812214-84812236 TTTCTCATGTTGAGAAGAAGAGG + Intronic
1086847953 11:91774904-91774926 TTTCTATAGATGAGAAAACTGGG - Intergenic
1087488215 11:98786383-98786405 TTTCTACTGTCAAGAAAAACCGG + Intergenic
1087871667 11:103301867-103301889 CTTCTATTTTTGAGAATATATGG + Intronic
1088081840 11:105926495-105926517 TTTTTATTGTTTAAAGAAAATGG - Intronic
1088145674 11:106673455-106673477 TTTGTATGGTTGAGACTAAATGG + Intergenic
1088863314 11:113822118-113822140 TTTATGTTGTTGTGAAAAGATGG + Intronic
1088947071 11:114525123-114525145 TCTCCATTGTTGAGACAAGATGG - Intronic
1089631096 11:119784694-119784716 TTTCTTTAGTTGAAAGAAAAGGG + Intergenic
1090997798 11:131882883-131882905 TTTCTTTTCCTGAGAAAATAGGG + Intronic
1092002362 12:5043472-5043494 TTTTTATTTTGGAGAAATAACGG - Intergenic
1092306652 12:7307768-7307790 TTTCTGCTGTTGTGAAACAAAGG - Intronic
1092311238 12:7356394-7356416 AATATATTTTTGAGAAAAAACGG + Intronic
1092445023 12:8547323-8547345 TTTCAATTATTAAGAAGAAAGGG - Intergenic
1093154252 12:15662086-15662108 TTTCTATAGTTGAGAAACCAAGG - Exonic
1093261589 12:16944326-16944348 TTTGTGTTGTTGAGATAAAATGG - Intergenic
1093388856 12:18592759-18592781 TTTATGTTGATGAGGAAAAACGG + Intronic
1093538918 12:20256949-20256971 TTTTTATTGTTGAGTTTAAAGGG + Intergenic
1093658059 12:21720526-21720548 TTTTTGTTGCTGAAAAAAAATGG + Intronic
1095655075 12:44659774-44659796 TTTTTGTTGTTGAAAAAAAAGGG - Intronic
1095762735 12:45858219-45858241 CTTCTATGGTTGAGATAAACAGG - Intronic
1096110473 12:49026255-49026277 GTTCTATTGGTGAGAACAACGGG - Exonic
1096142464 12:49253850-49253872 TTTCTTTTGTTTAGACAAATTGG - Intronic
1096623946 12:52881646-52881668 ATTCAAATGTTTAGAAAAAACGG - Intergenic
1097356908 12:58612431-58612453 TTTCTATTTTTCAGTAGAAACGG - Intronic
1097396842 12:59085435-59085457 TTTTTTTTTTTTAGAAAAAAAGG + Intergenic
1097472131 12:60007692-60007714 TTTCTAGTGTTGCCAAAGAAAGG + Intergenic
1097844686 12:64354166-64354188 TCTCTATTCTGGATAAAAAAGGG + Intronic
1098002398 12:65959353-65959375 TTTCTTTTGTTCATGAAAAAAGG - Intronic
1098077148 12:66744262-66744284 CTTCTATTCCTGAAAAAAAAAGG + Intronic
1098951914 12:76648495-76648517 TTTCTCTTTTTCAGAAAAAAAGG + Intergenic
1099083852 12:78220544-78220566 TGTATATTGTTGAGGAAATATGG - Intergenic
1099091256 12:78312155-78312177 GTTCATTTGTTGAGAAAAATAGG + Intergenic
1099127609 12:78783952-78783974 TTTCTATTTATGAGAACTAATGG - Intergenic
1099456447 12:82868704-82868726 TTTTTTTTTTTGAAAAAAAAAGG + Intronic
1099594823 12:84647587-84647609 TTTCTAATTTTGAAGAAAAATGG + Intergenic
1099653501 12:85459226-85459248 TTTCTATAGGTCACAAAAAAAGG + Intergenic
1099721674 12:86369752-86369774 TTTTTATTGTTGATTTAAAAAGG + Intronic
1099948023 12:89266994-89267016 TTTTTAGTGAAGAGAAAAAAAGG - Intergenic
1099950896 12:89302883-89302905 TTTTTTTTTTTAAGAAAAAAAGG + Intergenic
1100136014 12:91554304-91554326 TTTCTCTTGAAGAGAAAACAGGG - Intergenic
1100347197 12:93743759-93743781 TTTGAATTGTTTAGAAACAATGG + Intronic
1100931319 12:99613142-99613164 TTTCTATTGTTGAGTAAAGAAGG + Intronic
1100942033 12:99734267-99734289 TTTCTAGTAGAGAGAAAAAAAGG - Intronic
1101417417 12:104520488-104520510 TTTGTTTTGTTTAAAAAAAAAGG - Intronic
1101677591 12:106932421-106932443 TTTCATTTGTTAAAAAAAAAAGG + Intergenic
1102126439 12:110485487-110485509 TTTCTATTTTCAAGAAAAGATGG - Intronic
1102431180 12:112884033-112884055 GATATATTGTTAAGAAAAAAAGG - Intronic
1104037519 12:125107789-125107811 TTTGTATTTTTTAGTAAAAATGG - Intronic
1104325699 12:127794960-127794982 TTTCTAATTCTGAGAAAAAGAGG - Intergenic
1105343977 13:19556697-19556719 TTTCTATTTTTTAGAGAAAGGGG + Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1105536060 13:21264892-21264914 TTTCTATTTTTTAGAGAAAGGGG - Intergenic
1105677323 13:22686035-22686057 TTTCCTTTGTTGAAAACAAATGG - Intergenic
1105727325 13:23177522-23177544 TTTCTATACTTAAAAAAAAACGG - Intergenic
1106396272 13:29383902-29383924 TTCCTATTACTGAGAAAAAGTGG - Intronic
1107477476 13:40752910-40752932 TTTCTATTTTTTAGAGAAAGGGG + Intronic
1107797584 13:44068655-44068677 TTTCAATAGTTGAGGAAAAGGGG + Intergenic
1108313484 13:49217667-49217689 TTTCTCTTGTTGAGAGCACAGGG + Intergenic
1108624037 13:52210330-52210352 TTACTAGTGTTGGGAAAGAAAGG + Intergenic
1108662021 13:52596094-52596116 TTACTAGTGTTGGGAAAGAAAGG - Intergenic
1108850483 13:54722009-54722031 TTTCAATACTTCAGAAAAAAGGG + Intergenic
1109109624 13:58299970-58299992 TTTTTAATGTTAAGAAAAAATGG + Intergenic
1109773836 13:67013776-67013798 ATTCTATATTTGAGAAAAACAGG + Intronic
1109844401 13:67967599-67967621 TTTCTTTTCTAGAGAAGAAAAGG + Intergenic
1109853156 13:68094070-68094092 TATCTATTGCTGAGAAATGAGGG + Intergenic
1110221215 13:73076014-73076036 TTTGTATATTTGAGAAAACAGGG + Exonic
1110577960 13:77082150-77082172 TTTTTGTTTTTGAGAAATAAAGG + Intronic
1111812877 13:93113825-93113847 TTTCTAATGTTCCGAAAGAACGG + Intergenic
1111960366 13:94803637-94803659 TTTCTATTTTTTAAAAAAATAGG + Intergenic
1111977207 13:94978682-94978704 GTTTTGTTGTTGGGAAAAAAGGG - Intergenic
1112081345 13:95974908-95974930 TTTCTATTTTTGATAGAAACAGG - Intronic
1112282944 13:98078558-98078580 TTTTTTTTTTTGAGAAAGAAAGG - Intergenic
1112699353 13:101987495-101987517 TTGCTATGTTTTAGAAAAAAGGG - Intronic
1112903088 13:104383009-104383031 TTTCTATTCTTTTGAAAGAATGG - Intergenic
1113145865 13:107206614-107206636 TTCCTATTATTCACAAAAAAGGG - Intronic
1113209575 13:107959830-107959852 CTCATATTGTTGAGACAAAAGGG + Intergenic
1113425410 13:110203597-110203619 TTTCTTTTGTAGGGAGAAAAGGG - Exonic
1113742279 13:112719736-112719758 CTCCTATTTTTGAGAAAAACCGG + Intronic
1115372272 14:32630379-32630401 TTGCTATTGTAAGGAAAAAAAGG + Intronic
1115378480 14:32705865-32705887 TTACTATGGTAGAGAGAAAAGGG + Intronic
1115522670 14:34248529-34248551 TTTCTATTATTGTGGAAGAAAGG + Intronic
1115982889 14:39073173-39073195 TTTTTACTGCTGAGTAAAAAGGG - Intronic
1116008861 14:39327487-39327509 TTTATTTTGGTGAGATAAAATGG - Intronic
1116056422 14:39869742-39869764 AATCTATAGTTAAGAAAAAATGG + Intergenic
1116093933 14:40343631-40343653 TTTCTATTCTTAAGAAGAATTGG - Intergenic
1116316808 14:43406755-43406777 TTTGTAGTGTTAAGACAAAAGGG - Intergenic
1117196268 14:53342850-53342872 TTTGTATTATTGGGATAAAATGG - Intergenic
1117581386 14:57155027-57155049 TTATTATTATTGAGGAAAAAAGG - Intergenic
1117712244 14:58543183-58543205 TTTTTATAGTTGAGAAAACTGGG + Intronic
1117718410 14:58604177-58604199 TCTGTATTTTTAAGAAAAAAGGG + Intergenic
1117884981 14:60351226-60351248 TGTCTTTTTTTCAGAAAAAAAGG + Intergenic
1118131339 14:62967381-62967403 TTACTTATGTTTAGAAAAAAAGG - Intronic
1119358559 14:74028057-74028079 TATCTATTTTTGAAGAAAAAGGG - Intronic
1120007487 14:79375778-79375800 TATATATTGATGAGAAATAATGG - Intronic
1120096479 14:80394490-80394512 CATCTATTATTGAGAAACAAAGG - Intergenic
1120459791 14:84780361-84780383 TTTCTATGGTAGAGAAGGAAGGG - Intergenic
1120910257 14:89659897-89659919 TTTCTTTTTTTTAAAAAAAATGG + Intergenic
1123792947 15:23741080-23741102 TGTCAATTTGTGAGAAAAAAAGG + Intergenic
1124417427 15:29484603-29484625 TGTCTTTTACTGAGAAAAAAGGG + Intronic
1125236961 15:37525711-37525733 TTTTTTTTTTTTAGAAAAAAAGG + Intergenic
1125891678 15:43271191-43271213 TTTCTAGGGGTGAGAAAAGAAGG - Intergenic
1126288393 15:47043121-47043143 TTGCTCTTTTTCAGAAAAAAAGG + Intergenic
1126318971 15:47401395-47401417 ATTTTATAGATGAGAAAAAATGG + Intronic
1126444224 15:48724016-48724038 ATTCTATAGATGAGAAAGAAGGG - Intronic
1126793296 15:52240127-52240149 TTACTATTGTTGGTAAAAAATGG + Intronic
1127299187 15:57635896-57635918 TTTTTACTGATCAGAAAAAAAGG - Intronic
1129641961 15:77389323-77389345 TTTCTAATTCTGAGCAAAAAAGG + Intronic
1129765797 15:78166049-78166071 TTTGTATTGCTGAGGAAAGATGG + Intronic
1130881689 15:88060967-88060989 TTTTAATAGTTGAAAAAAAAAGG - Intronic
1131578657 15:93618318-93618340 TTTCTAATTTTGACAAGAAAAGG + Intergenic
1131949603 15:97666725-97666747 TTACTTTTGTGGAGAAAAAGAGG - Intergenic
1132254236 15:100361380-100361402 TTTCTATTTTTTAGTAGAAATGG - Intergenic
1132492932 16:243941-243963 TTTCCACTGTGGGGAAAAAACGG - Intronic
1134509147 16:14832525-14832547 TTTTTTTTTTTGAGACAAAATGG + Intronic
1134696849 16:16231360-16231382 TTTTTTTTTTTGAGACAAAATGG + Intergenic
1134974988 16:18563336-18563358 TTTTTTTTTTTGAGACAAAATGG - Intergenic
1135607974 16:23839207-23839229 TTTCTGATGTTAAGAGAAAAAGG + Intronic
1135673903 16:24398041-24398063 TTTGTATTGTTGAGTAGAACAGG - Intergenic
1135860148 16:26048962-26048984 TGTCCCTTATTGAGAAAAAACGG + Intronic
1137022834 16:35447069-35447091 TTTATGTTGTTGACAAAAACTGG + Intergenic
1137285851 16:47015085-47015107 TCTCTATTTTTGATAAAAATGGG + Intergenic
1137740900 16:50772465-50772487 TATCTATTGTTAAGTTAAAAAGG - Intronic
1137817788 16:51415589-51415611 TTTTTTTTTTTGAAAAAAAAAGG + Intergenic
1138139261 16:54553235-54553257 TGTCTGCTGTTGAAAAAAAATGG + Intergenic
1138293923 16:55870721-55870743 TTTTTATTGATTAGAAAAATTGG + Intronic
1138722234 16:59096038-59096060 ATTTTATTGTTGGGAAATAATGG - Intergenic
1138880101 16:61002810-61002832 TTTCTATTTATGATAACAAATGG + Intergenic
1140096168 16:71877428-71877450 TTTGTATTTTTTTGAAAAAACGG + Intronic
1140115344 16:72036771-72036793 TTTTTACAGTTGAGAAAACAGGG - Intergenic
1140167533 16:72568957-72568979 TATCTATGATGGAGAAAAAAGGG + Intergenic
1140282863 16:73570938-73570960 TTTTTTTTTTTGAGAAGAAAAGG - Intergenic
1140413884 16:74759560-74759582 TTTCTCTTGTTTAGAAAACAAGG - Intronic
1140776034 16:78249742-78249764 TTTCAATTCTTGGGAAGAAAGGG - Intronic
1141381120 16:83577995-83578017 ATTATATTGTTGAGAAGCAAAGG - Intronic
1141413015 16:83848850-83848872 TTTATATTGTTCAGTAAAAAGGG - Intergenic
1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG + Intronic
1143004305 17:3818027-3818049 TAGTTATTGTTGAGAAAGAATGG + Intronic
1143212323 17:5197522-5197544 TTTCTATTGTCTAAAAATAAAGG - Intergenic
1143353211 17:6305020-6305042 TTTCTATTCTTAACAGAAAAAGG + Intergenic
1143686348 17:8519590-8519612 TTTTTATTGTTAGGAGAAAAAGG - Intronic
1144619211 17:16805719-16805741 TTTCTAATCTTTAAAAAAAAGGG - Intergenic
1144893486 17:18509976-18509998 TTTCTAATCTTTAAAAAAAAGGG + Intergenic
1145138738 17:20434298-20434320 TTTCTAATCTTAAAAAAAAAGGG - Intergenic
1146150712 17:30467758-30467780 TATTTAATGTTGAGAATAAATGG - Exonic
1147023690 17:37561140-37561162 TTTCCATTTTTAATAAAAAAGGG - Intronic
1147114854 17:38291258-38291280 TTTCTATAGGTGAGGAAAAAAGG + Intergenic
1147395717 17:40140889-40140911 TTTTTGTTTTTGAGAGAAAAGGG + Intronic
1147998341 17:44373874-44373896 TTTCTCTAGTAGAGCAAAAAAGG - Intronic
1148054154 17:44783730-44783752 TTTCTACTTTTGAAAAATAAGGG - Intergenic
1148414761 17:47497946-47497968 TTTCCATAGGTGAGGAAAAAAGG - Intergenic
1149030288 17:52074867-52074889 TTTAAATGGTTGAAAAAAAAGGG + Intronic
1150228414 17:63536470-63536492 TTTGTATTTTTTAGTAAAAATGG - Intronic
1151172831 17:72262115-72262137 TTTATTTAGTTGAGAAAACAGGG + Intergenic
1151706158 17:75769057-75769079 TTTCTATTTTTTAGTAAAGATGG - Intergenic
1151900780 17:77012420-77012442 TTTCTATAGTTGAGACCAAATGG - Intergenic
1152172349 17:78760643-78760665 TTTCTAGTGTTTAGAAAAGAGGG - Intronic
1153463794 18:5366461-5366483 CTTCTATTGTTGAAAAGAAGTGG - Intergenic
1154476507 18:14764927-14764949 TTTCTATTTTTGAGATGGAATGG + Intronic
1154998153 18:21661067-21661089 TTTCTTTTGGTGAGAAAATAGGG - Intronic
1155079066 18:22389529-22389551 TCTCCATAGGTGAGAAAAAATGG + Intergenic
1155101086 18:22610612-22610634 TGTCTAATTTTCAGAAAAAAAGG + Intergenic
1156092058 18:33483201-33483223 GTTGTATTGTTAAGCAAAAAAGG - Intergenic
1156775755 18:40786451-40786473 TTTTGATTGTTGAAAAGAAAAGG - Intergenic
1156781836 18:40859423-40859445 TTTCTCTTCTTGAGTGAAAAAGG + Intergenic
1156857674 18:41801582-41801604 TTTCTAATACTGACAAAAAAGGG + Intergenic
1157180400 18:45492676-45492698 TTACTATTGCTAAGGAAAAAGGG + Intronic
1157670316 18:49522958-49522980 ATTTTATAGTTGAGAATAAAGGG + Intergenic
1158016985 18:52795054-52795076 TCTGTATTGATCAGAAAAAATGG + Intronic
1158022261 18:52857100-52857122 TTTCCATTTTGGAAAAAAAATGG + Intronic
1158067604 18:53431377-53431399 TTTGTGTTATTGAGAAAATATGG + Intronic
1158406822 18:57166963-57166985 TTACTGTTGTTGAGAAATTATGG + Intergenic
1159234434 18:65652532-65652554 TATTTATTGTTGAGAAACTAAGG + Intergenic
1160241811 18:77130380-77130402 TTTTTACTGTTGAGGAAACAAGG - Intronic
1163982341 19:20912807-20912829 TTCCCATTGTTGAGAATGAATGG - Intergenic
1164077297 19:21831909-21831931 TTTCTATTCATGAGCATAAACGG - Intronic
1164276904 19:23727243-23727265 TTTCTTTTTTTTAGTAAAAATGG - Intergenic
1165396677 19:35568184-35568206 TTTCTTTTCTTGAGAAAGAGGGG + Intergenic
1165536157 19:36447185-36447207 TTTGTATTTTTGAGTAAAAATGG + Intronic
1166323673 19:42035952-42035974 TTGCTATTGTTGTGCAAAATAGG + Intronic
1167774160 19:51543861-51543883 TTTCTAATTTTGAAAAAATATGG - Intergenic
1168112937 19:54204730-54204752 TTTCTAATGTAAAGACAAAAAGG + Intronic
1168570271 19:57461625-57461647 TTTCTATATCTGTGAAAAAATGG - Intronic
925339272 2:3124859-3124881 TTTTTAATGTTAAAAAAAAAAGG - Intergenic
925519973 2:4733365-4733387 TTTCTATTTTTTAGAAGAGACGG + Intergenic
925611119 2:5704366-5704388 TTTTAACTGTTGGGAAAAAATGG - Intergenic
925615281 2:5739544-5739566 TTTCTATTCATTAGAAATAAGGG + Intergenic
925625661 2:5840343-5840365 ATTCTATTGTGGAAAAATAAAGG - Intergenic
926183974 2:10673381-10673403 GTTCTATTGTTAAACAAAAATGG - Intronic
926278846 2:11427848-11427870 TTTCTTTTTTTGAAGAAAAATGG + Intergenic
926838895 2:17056563-17056585 TTTCGAAGGTTGAGAAAAATGGG - Intergenic
926949180 2:18222893-18222915 TTTAGATTGTTTAAAAAAAAAGG - Intronic
927346860 2:22054408-22054430 TTTCTTTTTTTTAGGAAAAATGG + Intergenic
928029565 2:27766993-27767015 TTTCTATTTTTTAGTAGAAATGG - Intergenic
928644959 2:33342153-33342175 TTTTTATTAATGAGAAAAAAAGG + Intronic
928868198 2:35943969-35943991 CGTCTATTGTTGAAAAAAAGTGG + Intergenic
929008344 2:37416988-37417010 ATTTTATTTTTGGGAAAAAATGG + Intergenic
930983149 2:57552238-57552260 GCTCCACTGTTGAGAAAAAAAGG - Intergenic
930987509 2:57608664-57608686 TTTCTTTTCTTTAGAAAAACAGG + Intergenic
931312820 2:61098461-61098483 GTTATGTTGTTGAGTAAAAAAGG - Intronic
931516770 2:63054720-63054742 TTTCTGTTTTTGAGATGAAAGGG + Intronic
931827078 2:66012245-66012267 TTTTTATTGCAGAGAAATAAAGG - Intergenic
931941913 2:67261560-67261582 TTTCTATTACTTAGAAAAATTGG + Intergenic
932037506 2:68261016-68261038 TTTGTATAGTTGTGGAAAAATGG - Intronic
932057688 2:68462660-68462682 TTTCTTTTGTTAAGAGTAAATGG + Exonic
932174799 2:69589904-69589926 TTTCTTCTGTGGAGACAAAATGG - Intronic
932930131 2:76026157-76026179 TTTCTATTTCTGTGAAAAAATGG - Intergenic
932933090 2:76065915-76065937 TTTCTATTTTTGAACAACAATGG + Intergenic
932981142 2:76668568-76668590 ATTATACTGTTGAGAATAAAAGG - Intergenic
933047127 2:77553418-77553440 TTTCTTTTATTAAGAAAATAAGG + Intronic
933059539 2:77720220-77720242 TTTCAACTCTTGGGAAAAAAGGG - Intergenic
933277116 2:80295584-80295606 GTTTTATTGTGGGGAAAAAATGG + Intronic
933420187 2:82035148-82035170 ATTCTTTTGTTGGGAAAAAAAGG + Intergenic
933434656 2:82232937-82232959 TTTCTATTATTTATTAAAAATGG - Intergenic
933447937 2:82405358-82405380 TTTTTATTGTTGGGATCAAATGG + Intergenic
933894890 2:86801653-86801675 TTTGTCTTTTTGAAAAAAAAAGG + Exonic
935322653 2:101903976-101903998 TTTCTATCATTTAAAAAAAATGG - Intergenic
935380969 2:102450834-102450856 TTCCTATTCTTCAGATAAAAAGG + Exonic
935997484 2:108789420-108789442 TTTCTATTTTTTAGTAGAAACGG - Intronic
936881435 2:117255942-117255964 GTTCTATAATTGAGAATAAAGGG + Intergenic
936936457 2:117843188-117843210 TTTCTATTTCTGAAAAAAAAAGG + Intergenic
937025994 2:118697680-118697702 ATTCTATTTTTGGGAAAAAATGG - Intergenic
937495938 2:122419342-122419364 TTTCGATAGAAGAGAAAAAAAGG + Intergenic
938684632 2:133726095-133726117 TTCCTATTTTTAAGAAAGAATGG + Intergenic
939118096 2:138084565-138084587 CTTCCTTTGTTAAGAAAAAAAGG - Intergenic
939322584 2:140643156-140643178 TTTCTGTATTTAAGAAAAAAGGG - Intronic
939472866 2:142646836-142646858 TTTCTATTTTGGATAAAATATGG + Intergenic
939558487 2:143705726-143705748 TTTCTTCAGTTGAAAAAAAAGGG - Intronic
939737213 2:145862506-145862528 TTTAAATTGTTGTGAGAAAATGG - Intergenic
939771397 2:146324200-146324222 ATTCTATTGCTGACAAAAAATGG - Intergenic
940740557 2:157502886-157502908 TTTCTATTTTTTAGTAGAAACGG + Intergenic
940955064 2:159718306-159718328 TTTCTATTTTGGAAAAAAATAGG + Intronic
941064916 2:160891071-160891093 TTACTATAGATGAGAAAAAAGGG - Intergenic
941255075 2:163219159-163219181 TTTTTAATGCTGGGAAAAAAAGG - Intergenic
941275163 2:163481799-163481821 TTTCTGCTGTTAAAAAAAAATGG + Intergenic
941297178 2:163754141-163754163 TTTTTATTGTTTTAAAAAAAGGG - Intergenic
941379032 2:164768564-164768586 TTTCTATAGATGAATAAAAATGG - Intronic
941788697 2:169526859-169526881 TATTTATGGTAGAGAAAAAAAGG - Intergenic
942528026 2:176876446-176876468 TTCTTATTGTTGATAAAAACAGG - Intergenic
942891056 2:180988895-180988917 TTTCAATTCTTCAAAAAAAAAGG + Intronic
943372380 2:187030739-187030761 TTTGTATTGGTGAGAAACAAGGG - Intergenic
943746107 2:191464035-191464057 TTTATAATGTTGAGAAACACTGG + Intergenic
943864489 2:192912052-192912074 TTTCAAATGTTAAAAAAAAATGG + Intergenic
943966166 2:194336775-194336797 ACACTATTGTTGAGAAAGAAAGG + Intergenic
943981356 2:194555296-194555318 TTTATATTTCTGAGCAAAAAAGG + Intergenic
944033180 2:195262143-195262165 TTCCTATTTTTCTGAAAAAATGG - Intergenic
944317485 2:198298546-198298568 TTTAAATTCTTCAGAAAAAAAGG - Intronic
944881328 2:204015883-204015905 TTTCTAATATTCAGAAAAATTGG - Intergenic
944988891 2:205211649-205211671 TTTCTAGTGTTCATAAGAAAAGG + Intronic
945220773 2:207481806-207481828 GTTCTCTTGATAAGAAAAAAAGG - Intergenic
945514132 2:210741138-210741160 GTTGTATTGTTTAGAAAATAAGG + Intergenic
945891890 2:215438309-215438331 TTTCTAAAGTTTAAAAAAAAAGG - Intergenic
946559744 2:220899095-220899117 TTTGTATTGTTTAGTAAAGAAGG + Intergenic
946584802 2:221173068-221173090 TATCTATTGTGGAGTACAAATGG - Intergenic
947073641 2:226318387-226318409 TTTTTTTTTTTGAGATAAAAGGG - Intergenic
947257893 2:228185708-228185730 TATCAACTGTTGAGAAAAAGTGG - Intergenic
947948775 2:234129720-234129742 ATTCTATTGATGAGAAGAAGTGG + Intergenic
948500661 2:238390959-238390981 TTTTCTTTTTTGAGAAAAAAGGG + Intronic
948617192 2:239207103-239207125 TTTCTATTGTAGAGAATTACAGG - Intronic
1169609150 20:7359757-7359779 TTTGACTTGTTCAGAAAAAAAGG + Intergenic
1169645466 20:7804500-7804522 GTTCTATTGTTAAGAAGAAAGGG - Intergenic
1169646024 20:7810898-7810920 TTTCTATTTTTTAGTAGAAACGG + Intergenic
1169744697 20:8931813-8931835 TTTCCTTTTTTCAGAAAAAAGGG + Intronic
1169869152 20:10232933-10232955 TTTTTATTGTTGAAAAATAAAGG - Intronic
1170046319 20:12089115-12089137 TTTCGATTTCTGAGAAAGAAAGG + Intergenic
1170251091 20:14283629-14283651 TTTTTAATGTGGAGACAAAAGGG + Intronic
1170307319 20:14952974-14952996 CTTCTATTTTTAAGAAAAGAGGG + Intronic
1170503975 20:17004826-17004848 CTTCTCTTTTTGAGAAAGAAGGG - Intergenic
1170698433 20:18681619-18681641 TTTCCAGTGTTGAGAGAAAAAGG + Intronic
1170925582 20:20720229-20720251 TTTCTATTGTACTGAAAAAATGG + Intergenic
1171063017 20:21984810-21984832 TTTCTATTGAAGAGATAAAATGG - Intergenic
1171569197 20:26231728-26231750 TTTCTACAGTTGACAAAATACGG + Intergenic
1171942405 20:31343789-31343811 ATTCTATTGTTGAAAAGCAAGGG - Intergenic
1172555804 20:35840286-35840308 TTTATATAGTTGAAATAAAAAGG + Intronic
1173242310 20:41308186-41308208 ATTCCATTTTAGAGAAAAAAAGG - Intronic
1173435998 20:43032802-43032824 TTAGTATTGTTGTGAAATAAAGG - Intronic
1174018389 20:47508039-47508061 ATTGTATTGTTTAAAAAAAAGGG + Intronic
1174262821 20:49309397-49309419 TTCTTATTGTTGAGTAATAAGGG + Intergenic
1174715479 20:52753303-52753325 TTTGTATTCTTCAGAAAAGAAGG - Intergenic
1174753334 20:53133958-53133980 TTTTTTTTTTTCAGAAAAAATGG - Intronic
1175482095 20:59319045-59319067 TTCCCATTCCTGAGAAAAAACGG + Intronic
1176721410 21:10396788-10396810 TTTCTTTTGGGGAAAAAAAAAGG + Intergenic
1177254873 21:18648439-18648461 TTGCTCTGGTTGGGAAAAAATGG - Intergenic
1177307506 21:19338658-19338680 TTACTTTTGTGGAGAAAAATGGG - Intergenic
1177349175 21:19912882-19912904 TTTCTTTTGATGAGAACACATGG + Intergenic
1177412145 21:20743222-20743244 TTTCTCTTGTGTAGAAAAATTGG - Intergenic
1177618182 21:23553209-23553231 TTTCTAGTGTTGACATTAAAAGG - Intergenic
1177816940 21:25987966-25987988 TTTGTATTATGGAGAAAAAGAGG + Intronic
1178558542 21:33616232-33616254 TTTCTATTGATGATAAAAATTGG - Intronic
1178677099 21:34640523-34640545 TTTCTTTTCTTAAGCAAAAAAGG + Intergenic
1178811831 21:35890933-35890955 CTTCTGCTGTTGAGAGAAAAGGG - Intronic
1179346028 21:40558139-40558161 TTTCTATCACTGAGAAAAACAGG + Intronic
1181674486 22:24442755-24442777 TTTCTTTTGTTAAGAACAGAAGG - Intergenic
1182597269 22:31431491-31431513 TTTTTATTTTTGATAAAAACGGG - Intronic
1184843837 22:47068742-47068764 GTGCTATTGTTTAGAATAAAAGG + Intronic
949227129 3:1708722-1708744 CTTCTATAGTAGAGAACAAATGG - Intergenic
949320796 3:2808417-2808439 TTTTCATTGGGGAGAAAAAAAGG + Intronic
951280178 3:20738392-20738414 TTTCTTTTTTTAAAAAAAAAAGG - Intergenic
951955903 3:28253134-28253156 TTTGTGCTGTTGAGAAAAACTGG + Intronic
952047121 3:29336016-29336038 TTTCCTTTGTTAAGAAAAACCGG - Intronic
952087309 3:29840365-29840387 TTTCATTTGTTTAGAAAATATGG - Intronic
952345393 3:32479334-32479356 TTTCTATTTCTGAGAAATAAAGG + Intronic
954567341 3:51609663-51609685 ATTCAGTAGTTGAGAAAAAAAGG - Intronic
955028796 3:55196582-55196604 GTTCTCTTATTGAGAAAAAAAGG - Intergenic
955060128 3:55486726-55486748 TTTTGATTTTTGAGAAAAAGTGG - Intronic
955307369 3:57847713-57847735 TTTCTTTTGTTCAGAAATAATGG + Intronic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
955451122 3:59067366-59067388 TTTCTATTTTTTAGTAGAAACGG + Intergenic
956521819 3:70112644-70112666 TTTACATTGTTGAGAAAGCATGG + Intergenic
956551866 3:70470227-70470249 TTTCTATAGATTAAAAAAAAAGG - Intergenic
957150222 3:76476820-76476842 TTTATATTCTTGGGAAAAAATGG + Intronic
958097618 3:88967099-88967121 TTTATATTGTTTAAAAAAAATGG + Intergenic
959524772 3:107364295-107364317 TTTCTATTTTTGATAAAGACGGG - Intergenic
960230325 3:115218776-115218798 TTTCTTTTGTGAAGAAAACAAGG + Intergenic
960332139 3:116373754-116373776 TTTGTATATTTAAGAAAAAAGGG + Intronic
960389629 3:117061228-117061250 TATCTTTTTTTAAGAAAAAAGGG + Intronic
960896418 3:122510854-122510876 TTTTTAATGTTGATAAAACAAGG + Intronic
962162747 3:133016623-133016645 TTTATATTATAAAGAAAAAATGG - Intergenic
963235900 3:142955561-142955583 TTTCTATTCTGAAGAAACAAGGG + Intronic
963380633 3:144525351-144525373 TTCCTATTACTGAGAAAGAAGGG + Intergenic
963632430 3:147749951-147749973 TTTCCAATATTGAGAAAATATGG - Intergenic
964060437 3:152515538-152515560 TTTCTGTTGTTAAGAAATAAGGG + Intergenic
964215256 3:154273219-154273241 TTTCTTTTGTTTACAAAATAGGG - Exonic
964839944 3:160982657-160982679 TTTGTATTGTGTAGAGAAAAAGG + Intronic
964905523 3:161715027-161715049 CTTCCTTTGGTGAGAAAAAAAGG + Intergenic
965322424 3:167266191-167266213 CTTCAAAAGTTGAGAAAAAAGGG - Intronic
965457839 3:168926103-168926125 TTTATATCGTTTAGAAAAATAGG + Intergenic
965521341 3:169670370-169670392 TTGCCATTGTTAAGAAAAGATGG + Intergenic
965572714 3:170187713-170187735 TTTATAATGTAAAGAAAAAAGGG + Intergenic
965966633 3:174499280-174499302 TTTATGTTGTTGAGATATAAGGG + Intronic
966093784 3:176173243-176173265 TTTGTATTTTTGAGGAAACAGGG - Intergenic
966157326 3:176930910-176930932 TTTCTAGTGTTAAGTAAAACTGG + Intergenic
966659570 3:182399136-182399158 TTTCTATTTCTGAGAAAAGGTGG + Intergenic
968557878 4:1258052-1258074 TTTCCATTTCTGAGAAAAAAAGG + Intergenic
969993607 4:11289754-11289776 TTTGTACTGTTGCTAAAAAAAGG + Intergenic
970036903 4:11746466-11746488 TTTTTTTTTTTGAGAGAAAAGGG - Intergenic
970913013 4:21300275-21300297 TTTTTATAGTTGAAAGAAAAAGG + Intronic
971138170 4:23892995-23893017 TTTCTATTGTTGAGAAAAAATGG - Intronic
971348071 4:25829878-25829900 TTTTTCTTGCTCAGAAAAAAAGG + Intronic
971663377 4:29449935-29449957 TTTGTAATGTGGAAAAAAAAAGG + Intergenic
972090672 4:35278115-35278137 ATTCTATTGATCAGACAAAATGG + Intergenic
972819195 4:42680043-42680065 TTTCCATGGTTTAGAATAAAAGG + Intergenic
973572938 4:52258668-52258690 TTGCTATTGTTGGGCAAATATGG + Intergenic
973653858 4:53025082-53025104 TTACTATAGTTACGAAAAAAAGG + Intronic
974366770 4:60960342-60960364 TTTATAATTTAGAGAAAAAAAGG + Intergenic
974487139 4:62520675-62520697 TCTCTGTTGTTGAAAAAGAAAGG - Intergenic
974712646 4:65620680-65620702 TATTTATTGTTGTGAAATAAAGG + Intronic
974913524 4:68151072-68151094 TTTCCATAGTTAAGGAAAAATGG - Intergenic
975344532 4:73278888-73278910 TTTCTAATTATGTGAAAAAATGG + Intergenic
975460340 4:74645267-74645289 TTTCTATCTCTGTGAAAAAATGG - Intergenic
976003790 4:80402816-80402838 TTTCTATGATTGAGAATACATGG - Intronic
976152173 4:82103376-82103398 TTTCCAGAGATGAGAAAAAATGG + Intergenic
977444105 4:97106815-97106837 TTTCTATTGTAGAGAAAGATAGG + Intergenic
977444292 4:97109829-97109851 GTTCTAGAGTTAAGAAAAAATGG - Intergenic
977518341 4:98050438-98050460 TTTTTATTTTTTAAAAAAAAGGG + Intronic
977621375 4:99141514-99141536 TTTATTTTATTCAGAAAAAATGG - Intronic
977807272 4:101315855-101315877 TTTCTAGTGATGAGCAGAAAAGG - Intronic
978290426 4:107131917-107131939 TTCCTATGGTGGGGAAAAAAAGG - Intronic
978855763 4:113392912-113392934 ATTCTATGGGTAAGAAAAAAAGG + Intergenic
979120883 4:116899475-116899497 TTGCTAGTGTTGATAACAAAGGG - Intergenic
979388211 4:120095189-120095211 TTCCCATTTTTGAGACAAAATGG - Intergenic
979414838 4:120424082-120424104 TTAATATTTTTGAGATAAAAAGG - Intergenic
979722341 4:123916084-123916106 TTACTATTGTTGTGGGAAAAAGG - Intergenic
979787675 4:124736624-124736646 TTTCTAATCTAGAGAATAAAAGG - Intergenic
980237027 4:130121650-130121672 TATCTTTTGTTGGGACAAAATGG + Intergenic
980254962 4:130367476-130367498 TTTATATTGATGATTAAAAATGG - Intergenic
980538716 4:134164746-134164768 TTTCTAATTCTGTGAAAAAATGG - Intergenic
980563980 4:134513448-134513470 TTCCAATTGATGACAAAAAAAGG - Intergenic
980662355 4:135879071-135879093 TTTCAATTGTAGAGCCAAAAAGG + Intergenic
981934659 4:150226588-150226610 TTTCCATGGTTGGAAAAAAAAGG + Intronic
982560526 4:156923986-156924008 TGTCTATTCCTGAGAAGAAATGG + Intronic
982754336 4:159200713-159200735 TTGCTATTGTTTGGAAAATAAGG + Intronic
982900809 4:161001229-161001251 TTTCTATTGGTATTAAAAAATGG - Intergenic
983160758 4:164411258-164411280 TTTAAATTTTTGAAAAAAAAGGG - Intergenic
983225147 4:165079045-165079067 TTTCTATTCTTAAGAAATAAGGG - Exonic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983715920 4:170781160-170781182 TTTCTATTGTTGGTAAAGACGGG + Intergenic
983751003 4:171270625-171270647 TTTCTACTGATGAAAAAGAAGGG - Intergenic
984197933 4:176682007-176682029 TTTCTATTTTTTAGTAACAATGG - Intergenic
984277172 4:177625174-177625196 TTTGAATTGATAAGAAAAAATGG - Intergenic
984280590 4:177665885-177665907 TTTGGATTTTTGAGGAAAAAGGG + Intergenic
984363976 4:178774490-178774512 TTTCTATTTTTGGGAAAGACGGG - Intergenic
984464527 4:180081060-180081082 TCTTTAATGGTGAGAAAAAAAGG - Intergenic
984608709 4:181813919-181813941 TTTCAATTAATAAGAAAAAATGG + Intergenic
984667621 4:182446092-182446114 TTTCTATTGTTGAAAAGTGAAGG - Intronic
985306680 4:188550105-188550127 TTTCTTTTGTTGAAAAAACTCGG + Intergenic
985813493 5:2109218-2109240 TTTCTATTGCTGAAAACAATTGG + Intergenic
986100273 5:4601940-4601962 TCACTAGTTTTGAGAAAAAAAGG - Intergenic
986814329 5:11391808-11391830 TTACTGTTGGTGAGAAAAGAAGG + Intronic
987020560 5:13866396-13866418 TTTTTATTTGTTAGAAAAAAAGG + Intronic
987248426 5:16074526-16074548 TTTCTACTGTTGACTATAAATGG + Intronic
987634643 5:20524719-20524741 TAGGTATTGTTGAGAAGAAAAGG + Intronic
987855840 5:23419801-23419823 TTTCTATTTTTCACAAGAAATGG - Intergenic
987976017 5:25015984-25016006 TTTCAATATTTGAGAAAAATAGG + Intergenic
988011869 5:25498919-25498941 TTTTTATTGATGGCAAAAAAAGG + Intergenic
988201352 5:28074013-28074035 ATTCATTTGTTGATAAAAAATGG + Intergenic
988203543 5:28101714-28101736 TTTCTATTTCAGAAAAAAAATGG - Intergenic
988391037 5:30631386-30631408 TTGCTACTGTTTAGAAATAAGGG + Intergenic
988407681 5:30844914-30844936 TCTATATTGTTAAGTAAAAAAGG + Intergenic
988446398 5:31290661-31290683 GTTCTTTTCTTGGGAAAAAAAGG - Intronic
988729676 5:33959067-33959089 TTTCTATAATAGATAAAAAAAGG - Intronic
989347138 5:40441704-40441726 TTTCCATTGTTGAGCATTAACGG - Intergenic
989748910 5:44867457-44867479 TATTTATTTTTGAGTAAAAATGG + Intergenic
990333949 5:54754286-54754308 TCTCTATTTTTGAAAAAGAATGG + Intergenic
990403858 5:55468276-55468298 TCTCCATTGTAAAGAAAAAAGGG - Intronic
990445074 5:55886662-55886684 TTTCCATTGTTGATGGAAAAGGG + Intronic
990666819 5:58082022-58082044 GTTCTATTGTTGCAAAGAAAAGG - Intergenic
990856756 5:60276202-60276224 TATCAATTGTTGAGAAAGAAGGG + Intronic
991369098 5:65899718-65899740 TTTCTTTTGTGGTGAAAAATAGG - Intergenic
991695534 5:69267468-69267490 TTTGTATTTTTTAGTAAAAATGG + Intronic
992000411 5:72430744-72430766 TTTATATTCGTGAGAAAAGAAGG + Intergenic
992019258 5:72606137-72606159 TTTCAATAGTTGACTAAAAATGG + Intergenic
992187784 5:74260605-74260627 TTTCTATTGCTGGGAAATATTGG + Intergenic
992674541 5:79092495-79092517 TTTCCAGTGCTGGGAAAAAAGGG + Intronic
992834760 5:80629270-80629292 TTACCATTGTGAAGAAAAAAGGG - Intronic
993071502 5:83170029-83170051 TCTCTATTCTATAGAAAAAATGG - Intronic
993219490 5:85072647-85072669 TTTTTATTTTACAGAAAAAATGG + Intergenic
993788455 5:92174743-92174765 TTTGTATTGTTGAATAAAACAGG - Intergenic
993894712 5:93520487-93520509 TTCCTCTTGTTGAGTGAAAAAGG - Intergenic
994128719 5:96199229-96199251 ATTTTATTTTTGAGAAAGAAAGG + Intergenic
994422845 5:99543792-99543814 TTTTTGTTTTTGAGAGAAAATGG + Intergenic
994995892 5:107062350-107062372 TTTAAATTGTAGAGAAATAATGG + Intergenic
995695486 5:114874435-114874457 TTCCTATTTTTGGGAAATAAAGG + Intergenic
996206864 5:120750059-120750081 TTTATTTTGTTGTGAAAAATTGG + Intergenic
996457963 5:123706925-123706947 TTACTTTTTTTGAGAAAAAATGG + Intergenic
996512894 5:124337247-124337269 TTTCTATCATCTAGAAAAAAAGG - Intergenic
997500279 5:134368444-134368466 TTTCTATTTTTTAGTAGAAATGG - Intronic
997724076 5:136105669-136105691 TTTCTTATGTTAAAAAAAAAAGG - Intergenic
998749568 5:145304672-145304694 TTAATATTGTTGAAAAAAATGGG - Intergenic
998841395 5:146258278-146258300 TTTCTATTTTTTATAGAAAAAGG + Intronic
998865978 5:146502804-146502826 TTTATATTTTGGTGAAAAAAAGG - Intronic
999435203 5:151558302-151558324 AATATATTGTTGAGTAAAAAAGG + Intronic
999549277 5:152667068-152667090 ATTATAATGTTGAGAAAAAATGG - Intergenic
1000076788 5:157796375-157796397 TCACTAAAGTTGAGAAAAAAAGG - Intronic
1000078514 5:157820017-157820039 TTTCTTTGGTTGAAAAACAATGG + Intronic
1000416277 5:160987201-160987223 TTTTCAATGTTCAGAAAAAAAGG + Intergenic
1000553907 5:162700299-162700321 TTTCTATTTTGGAGAAAGCATGG + Intergenic
1000822777 5:166005183-166005205 TTTCAAATTTTGAGAAGAAAAGG - Intergenic
1001123838 5:169001744-169001766 TTTAAATTGTTGACAAAAATGGG - Intronic
1002804464 6:559348-559370 TATCTAATGTTTAGAAAAATGGG + Intronic
1003075425 6:2979814-2979836 TTACTATTGTTGATGAAAAGAGG - Intergenic
1003388661 6:5692934-5692956 TTTCTGGTGGGGAGAAAAAAAGG - Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003564637 6:7212890-7212912 TTTCCATTGGTGAGGGAAAAAGG + Intronic
1003803709 6:9701591-9701613 TTTCAAGTGGAGAGAAAAAAGGG + Intronic
1004101183 6:12613421-12613443 TATGTATTGTAGAGAAGAAATGG - Intergenic
1004789841 6:19012762-19012784 TTTCTAATGTGCAGAAAGAAAGG - Intergenic
1004994382 6:21174575-21174597 TTTTAATTGTTGACATAAAAGGG - Intronic
1005413767 6:25579759-25579781 TATTTATTGTTGAGAGAAAAGGG - Intronic
1005473793 6:26187826-26187848 TTTCTATTGTTGAATTTAAAAGG - Intergenic
1005658854 6:27973049-27973071 GTTATATTGTGGATAAAAAAAGG - Intergenic
1005763845 6:28991455-28991477 TTTTTAATGTTAAGAAAAAATGG + Intergenic
1006094918 6:31649928-31649950 TTTGTATTTTTGGTAAAAAAGGG - Intronic
1006342997 6:33457069-33457091 TGTCTATTGGTGAGAAAGCAAGG - Exonic
1006711947 6:36081760-36081782 TTTCTATTTCTGCAAAAAAAAGG + Intronic
1007986832 6:46215698-46215720 TTTATATTTTTTAGAAGAAATGG - Intergenic
1008141604 6:47838517-47838539 TTTCTACTTTTTAGTAAAAATGG + Intergenic
1008216978 6:48804186-48804208 ATTCTTTTGTTCAGAAAGAATGG + Intergenic
1008974804 6:57412165-57412187 ATTTTATTGTTGAGATAATATGG + Intronic
1009163690 6:60313671-60313693 ATTTTATTGTTGAGATAATATGG + Intergenic
1009556994 6:65183151-65183173 TTTTAAATGTTGAGAAATAAAGG + Intronic
1009817057 6:68749532-68749554 ATTCTAATGTTGAATAAAAATGG + Intronic
1009903348 6:69837122-69837144 TTTGTATTTTTGAGAAATTATGG - Intergenic
1010533890 6:77001533-77001555 TTTCTCTTATTGAGTTAAAAAGG - Intergenic
1011584175 6:88906819-88906841 TTTCTCTAGTAGAAAAAAAACGG + Intronic
1011932767 6:92735225-92735247 TTTATAATGTTGAGCACAAAAGG - Intergenic
1012198626 6:96376976-96376998 TTTCTATTTTTTAGTAGAAACGG - Intergenic
1012476954 6:99624260-99624282 TTTCTATTTTTGATAAAGATGGG - Intergenic
1013064988 6:106675323-106675345 TTTTTATTGTTGAGTTTAAAAGG + Intergenic
1013346600 6:109266299-109266321 TTTATATTGCTGTGAAAATAGGG + Intergenic
1013679271 6:112505152-112505174 GATCTATTGTTCAGAAAAAGGGG + Intergenic
1015175383 6:130301553-130301575 TTTCTAATTCTGTGAAAAAATGG - Intronic
1015455952 6:133426517-133426539 TTACTATAGTTTAGAAAAGAGGG - Intronic
1015789789 6:136955012-136955034 TTTTTATTCTTGTGAAGAAAGGG + Intergenic
1016276399 6:142358578-142358600 TTTGTATTGTTTATATAAAAAGG + Intronic
1016475892 6:144427587-144427609 TTTTTGTTGTTGATAATAAAAGG + Intronic
1016632978 6:146253419-146253441 ATTTTATTGTTGATGAAAAATGG + Intronic
1016724292 6:147343471-147343493 TTTCTTTTCTTGAAAAATAAAGG - Intronic
1016762075 6:147748633-147748655 TTTCACTTGGAGAGAAAAAAGGG + Intergenic
1016796162 6:148119803-148119825 TTTCTATTATTGACAACAAAAGG + Intergenic
1016952469 6:149593505-149593527 TTTCTATGGTTGGGATAACATGG + Intergenic
1017079747 6:150656246-150656268 TAACTATTCTTGAGAGAAAAAGG + Intronic
1017289076 6:152713806-152713828 TTTCTGATCTTGAGAAACAAAGG - Intronic
1017428299 6:154344741-154344763 TCTGTTCTGTTGAGAAAAAAAGG - Intronic
1018002270 6:159589807-159589829 TTTCTATAGATGAGAAAACTGGG + Intergenic
1018524337 6:164690947-164690969 CTTCTGTTGTTGAGAAACGATGG + Intergenic
1019476103 7:1245153-1245175 TTACTATTGTTGTGGAAAATTGG + Intergenic
1020583308 7:10032699-10032721 TTGCTATTATTCACAAAAAAGGG + Intergenic
1020626352 7:10585115-10585137 TTTTTAATGGTGAGGAAAAAAGG - Intergenic
1020697346 7:11430116-11430138 TCTCTGCTGTTGAGATAAAATGG - Intronic
1021346501 7:19535641-19535663 TCTGAATTATTGAGAAAAAATGG - Intergenic
1022673286 7:32475953-32475975 TTTTTTTTTTTAAGAAAAAATGG - Intergenic
1023656187 7:42423184-42423206 TTTTTAATGTGGGGAAAAAAAGG + Intergenic
1023958465 7:44907007-44907029 TTTACATTATTGAGAAAACATGG + Intergenic
1024178025 7:46861037-46861059 TTTCTCTTGTCGAGAAATGAAGG - Intergenic
1024378423 7:48665788-48665810 TCTGAATTGTTCAGAAAAAAAGG - Intergenic
1024675009 7:51630459-51630481 TTTCTATTTTTGAGTACAAATGG - Intergenic
1025323117 7:58169771-58169793 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025323332 7:58173855-58173877 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025323450 7:58175900-58175922 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025325231 7:58207908-58207930 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025325518 7:58213020-58213042 TTTCTACTGTTGGCAACAAATGG - Intergenic
1025329653 7:58286331-58286353 TTTCTACTGTTGACATCAAATGG - Intergenic
1025332143 7:58330280-58330302 TTTCTACTGTTGACATCAAATGG - Intergenic
1025333668 7:58357111-58357133 TTTCTACTGTTGGCAACAAATGG - Intergenic
1025334342 7:58369026-58369048 TTTCTACTGTTGACATCAAATGG - Intergenic
1025337041 7:58416715-58416737 TTTCTACTGTTGACATCAAATGG - Intergenic
1025337963 7:58433071-58433093 TTTCTACTGTTGACATCAAATGG - Intergenic
1025340847 7:58484167-58484189 TTTCTACTGTTGACATCAAATGG - Intergenic
1025344594 7:58550594-58550616 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025358300 7:58793259-58793281 TTTCTACTGTTGACATCAAATGG - Intergenic
1025358356 7:58794281-58794303 TTTCTACTGTTGGCAACAAATGG - Intergenic
1025362505 7:58867875-58867897 TTTCTACTGTTGACATCAAATGG - Intergenic
1025368616 7:58976209-58976231 TTTCTACTGTTGACATCAAATGG - Intergenic
1025378086 7:59144169-59144191 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025378176 7:59145871-59145893 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025380931 7:59194586-59194608 TTTCTACTGTTGACATCAAATGG - Intergenic
1025382663 7:59225252-59225274 TTTCTACTGTTGACATCAAATGG - Intergenic
1025382950 7:59230360-59230382 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025384725 7:59262028-59262050 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025388574 7:59330497-59330519 TTTCTACTGTTGGCAACAAATGG - Intergenic
1025390568 7:59365915-59365937 TTTCTACTGTTGACATCAAATGG - Intergenic
1025392497 7:59400323-59400345 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025394173 7:59429967-59429989 TTTCTACTGTTGACATCAAATGG - Intergenic
1025394403 7:59434057-59434079 TTTCTACTGTTGGCAACAAATGG - Intergenic
1025396697 7:59474925-59474947 TTTCTACTGTTGACATCAAATGG - Intergenic
1025397907 7:59496389-59496411 TTTCTACTGTTGACATCAAATGG - Intergenic
1025399053 7:59516349-59516371 TTTCTACTGTTGACATCAAATGG - Intergenic
1025399974 7:59532698-59532720 TTTCTACTGTTGGCAACAAATGG - Intergenic
1025400400 7:59540193-59540215 TTTCTACTGTTGACATCAAATGG - Intergenic
1025402812 7:59582767-59582789 TTTCTACTGTTGACATCAAATGG - Intergenic
1025410202 7:59713587-59713609 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025412850 7:59760602-59760624 TTTCTACTGTTGACATCAAATGG - Intergenic
1025412963 7:59762646-59762668 TTTCTACTGTTGACATCAAATGG - Intergenic
1025417216 7:59838287-59838309 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025417830 7:59849189-59849211 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025419827 7:59884616-59884638 TTTCTACTGTTGACATCAAATGG - Intergenic
1025420175 7:59890752-59890774 TTTCTACTGTTGACATCAAATGG - Intergenic
1025428748 7:60043372-60043394 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025429767 7:60061429-60061451 TTTCTACTGTTGACATCAAATGG - Intergenic
1025434017 7:60137061-60137083 TTTCTACTGTTGACATCAAATGG - Intergenic
1025434782 7:60150692-60150714 TTTCTACTGTTGACATCAAATGG - Intergenic
1025436446 7:60180321-60180343 TTTCTACTGTTGACATCAAATGG - Intergenic
1025442762 7:60292421-60292443 TTTCTACTGTTGGCAACAAATGG - Intergenic
1025446606 7:60360561-60360583 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025453373 7:60480827-60480849 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025454725 7:60505022-60505044 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025457343 7:60551690-60551712 TTTCTACTGTTGACATCAAATGG - Intergenic
1025457629 7:60556800-60556822 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025459592 7:60591895-60591917 TTTCTACTGTTGACATCAAATGG - Intergenic
1025461236 7:60621201-60621223 TTTCTACTGTTGACATCAAATGG - Intergenic
1025462251 7:60639263-60639285 TTTCTACTGTTGACATCAAATGG - Intergenic
1025470902 7:60793600-60793622 TTTCTATTGTTGGCATCAAATGG - Intergenic
1025537579 7:61974717-61974739 TTTCTATTGTTGGCATCAAATGG - Intergenic
1026013331 7:66653840-66653862 TTTGTATTTTTTAGAAAAGACGG + Intronic
1026325224 7:69303450-69303472 TTTGTATTTTTGGGAAAAATAGG + Intergenic
1026829389 7:73601700-73601722 TTTGTATTTTTTAGCAAAAATGG + Intronic
1027496677 7:78895814-78895836 TTTATAGTTTTGAGGAAAAAGGG + Intronic
1027529164 7:79308810-79308832 TTTCTTTTCTTAAGAAAATAAGG + Intronic
1027562070 7:79742841-79742863 TTTCTACTATTAAGAAAAAGAGG - Intergenic
1027721849 7:81752710-81752732 TCTCAATTGTGCAGAAAAAAGGG - Intronic
1028044386 7:86097592-86097614 TTTCTATTTCTGATAAAAATTGG + Intergenic
1028444666 7:90907615-90907637 TTTCAATTGTTCACAAAAAAAGG - Intronic
1028619976 7:92814662-92814684 TTTCTTTTACTGAGAAAGAATGG - Intronic
1029660273 7:101955881-101955903 TTTCTAAGGTTAAAAAAAAAAGG + Intronic
1030058689 7:105606049-105606071 TTTCTTTTTTTAAAAAAAAAAGG - Exonic
1030332934 7:108292341-108292363 TTTCTTTACTTGTGAAAAAACGG + Intronic
1030482964 7:110127416-110127438 TTTCTATTTTTAAGAGAAATAGG + Intergenic
1031031488 7:116740309-116740331 TTTTTCTTGTTGAGAAATATAGG - Intronic
1031273477 7:119686266-119686288 TTTTAATTGTTAAGAATAAAAGG - Intergenic
1031875458 7:127134268-127134290 TTTCCTTCGTTAAGAAAAAATGG + Intronic
1032443085 7:131957273-131957295 AATCTATTTTTGAGGAAAAAAGG + Intergenic
1032823255 7:135544246-135544268 TTTGTTTTCTTGGGAAAAAAGGG + Intergenic
1032878641 7:136065370-136065392 TTTCTGTTACTGAGAAAGAAGGG + Intergenic
1033304756 7:140216751-140216773 TCTCTATGATTCAGAAAAAAAGG + Intergenic
1033881793 7:145893349-145893371 TTTTTATTATTTAAAAAAAAAGG - Intergenic
1034012512 7:147545217-147545239 CTTGTATTGTTGAGCACAAAAGG - Intronic
1034118533 7:148606319-148606341 ATTCTAATGTTGAGAAACAGTGG - Intronic
1034732934 7:153403635-153403657 TTTCGGTGCTTGAGAAAAAAAGG + Intergenic
1035693855 8:1578759-1578781 TTTTTATTTTTGAGAGCAAAAGG - Intronic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036220171 8:6914817-6914839 TTTCAATCAATGAGAAAAAAAGG + Intergenic
1037437990 8:18884383-18884405 TTTCTATTGCTGGGCAAAATGGG - Intronic
1039441746 8:37599834-37599856 TTTCTCTTGTTGAGTGCAAATGG - Intergenic
1039452520 8:37686979-37687001 ATTCTATTTTTTAAAAAAAAGGG + Intergenic
1039569046 8:38572289-38572311 CTTCACTTGTTGAAAAAAAAAGG + Intergenic
1039716520 8:40115470-40115492 TTTTTAGTGATGAGACAAAAAGG - Intergenic
1039995632 8:42530252-42530274 TTTCTAATGTAGAAAAAATATGG - Intronic
1040634767 8:49259998-49260020 TTTCTTTTATTGAAAATAAATGG + Intergenic
1041168023 8:55110596-55110618 TTACTAGTGTTGGGAAAATAGGG + Intronic
1041168569 8:55116542-55116564 TGTCTATAGTTTAGAATAAAGGG + Intronic
1041187862 8:55320546-55320568 TTTCTACTTTTGTGAAAAGAAGG - Intronic
1041622245 8:59985424-59985446 TTTCTATTTCTGTGAAAAAATGG + Intergenic
1042474246 8:69227827-69227849 TTTAAATTACTGAGAAAAAATGG - Intergenic
1042983185 8:74553403-74553425 TTTCAATTACTCAGAAAAAATGG + Intergenic
1043300990 8:78731813-78731835 TTTGAATTTTTGAGAAAAATTGG - Intronic
1043534600 8:81188546-81188568 TTTCTAATTTTCAGAAAGAAAGG + Intergenic
1043619137 8:82166055-82166077 TTTCTATTGATGAAATGAAATGG - Intergenic
1044359405 8:91263964-91263986 CTTCTACTGTTAAAAAAAAATGG - Intronic
1044631740 8:94286896-94286918 TAGCTACTGTAGAGAAAAAAGGG + Intergenic
1045362335 8:101444493-101444515 TTTTTACTTTTGAGTAAAAAAGG - Intergenic
1045401477 8:101823256-101823278 TTTCAATTATGTAGAAAAAATGG - Intronic
1045904311 8:107324584-107324606 TTTCCATTGTTTAGAAGAAGAGG + Intronic
1045979312 8:108166153-108166175 TCTTTATTGATGAGAAAAATTGG + Intergenic
1046345301 8:112917043-112917065 TTTCCATTGTTTATAAAGAAAGG + Intronic
1046445629 8:114314287-114314309 AATTTATTGGTGAGAAAAAACGG + Intergenic
1046469425 8:114650718-114650740 TTAATATTGGTGATAAAAAATGG - Intergenic
1046515157 8:115249837-115249859 TATCTATTGATGACAAAAAAAGG - Intergenic
1046535372 8:115502156-115502178 TTTGTTCTGTTAAGAAAAAAAGG - Intronic
1046690041 8:117272960-117272982 TTTCTCTAGTTCAGAAAACAGGG - Intergenic
1046828042 8:118713535-118713557 TTTTTATTATTGAGAAAACATGG - Intergenic
1047164252 8:122419377-122419399 TTTATATTGCTGAGGAAAATGGG - Intergenic
1047371537 8:124260082-124260104 TTTCTATGTTTGGGGAAAAAGGG + Intergenic
1047589270 8:126309867-126309889 TTCCTTTTCTTGAGAAGAAAAGG - Intergenic
1047697057 8:127414537-127414559 ATTTTATGGTTGAGAAACAAGGG + Exonic
1047834449 8:128673118-128673140 TTTTTAATGTGGAGGAAAAAGGG + Intergenic
1047895263 8:129359568-129359590 TATGTTTTGTTGGGAAAAAAAGG + Intergenic
1047987389 8:130248935-130248957 TTTCTATTTTTTAGAAACAGGGG + Intronic
1048287213 8:133151279-133151301 TTTCTTTTAATGAGAATAAATGG + Intergenic
1048679982 8:136830720-136830742 TTTCTTTTCTTGAAAAGAAAAGG - Intergenic
1048971351 8:139646622-139646644 TTTTTATTGCTGGGAAAAACAGG + Intronic
1050085765 9:1964206-1964228 TTTCTTTGCTTGAGAAAAACAGG - Intergenic
1050662381 9:7896811-7896833 TTTCCATTGATCAGAAAATAAGG - Intergenic
1050676203 9:8056759-8056781 TATCTATGGTTAAAAAAAAAAGG + Intergenic
1050719165 9:8565302-8565324 TTACTATTCTAGGGAAAAAAAGG - Intronic
1050949419 9:11568813-11568835 TTTATATTCATGAGAAAAGATGG + Intergenic
1050993841 9:12188220-12188242 TTTTTTTTCTTTAGAAAAAATGG - Intergenic
1051412142 9:16800872-16800894 TTTCTGATGTAGAAAAAAAAGGG + Intronic
1051522268 9:18002260-18002282 CTTCTATTTCTGTGAAAAAATGG - Intergenic
1052036235 9:23684172-23684194 TTTCTTTTGCTAAGAAAAGAAGG + Intergenic
1052208950 9:25878352-25878374 TTTCTATTTTAAAGAAAAATAGG - Intergenic
1052361503 9:27565699-27565721 TTTCTACTTTAGGGAAAAAATGG + Intronic
1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG + Intergenic
1053325759 9:37148739-37148761 TTTCTAAGTTTGAGAAACAAAGG + Intronic
1054964538 9:71007415-71007437 CGTGTGTTGTTGAGAAAAAATGG - Intronic
1055273267 9:74585655-74585677 TTTTTATAGCGGAGAAAAAAGGG - Intronic
1055289592 9:74769020-74769042 TATCTATTATTAAGTAAAAATGG - Intronic
1055379722 9:75693065-75693087 TCTCTATTCTTGATAAAAACAGG - Intergenic
1055407688 9:75991738-75991760 TTTCTTTAGTCGTGAAAAAACGG - Intronic
1055556070 9:77475330-77475352 TTGCTATGGTTAAGAAAACATGG + Intronic
1055774044 9:79748833-79748855 TTTTTTTTGTTGTGAAAGAATGG + Intergenic
1055969977 9:81902192-81902214 TTTCTCTTTTTGAAATAAAATGG - Intergenic
1056228708 9:84522919-84522941 ATTCTACTGCTGAGAGAAAAAGG + Intergenic
1056244407 9:84679883-84679905 TTTCTATTGGTGGGAAACCATGG - Intronic
1056364963 9:85895128-85895150 TTCATCCTGTTGAGAAAAAACGG + Intergenic
1056680346 9:88712114-88712136 TAACTATTTTTGAGAAAAAAAGG + Intergenic
1057317997 9:93983201-93983223 TTTCTAATTCTGTGAAAAAATGG - Intergenic
1057621488 9:96639920-96639942 TTTCTATTTTTTAGTAAAGATGG - Exonic
1058158944 9:101546375-101546397 TTTCTTTTGTTGTGAATGAATGG + Intronic
1058260860 9:102829506-102829528 TTTCTATTTTTTTAAAAAAACGG - Intergenic
1058426455 9:104879344-104879366 ATTTTATAGTTGAGGAAAAAAGG + Intronic
1058779685 9:108320401-108320423 TTTGAATTGACGAGAAAAAAGGG - Intergenic
1058887670 9:109334142-109334164 TTTTTGTTTTTGGGAAAAAAAGG - Intergenic
1059194641 9:112359268-112359290 TTTCTATTTTTTAGTAAAGATGG - Intergenic
1059276500 9:113101730-113101752 TTTATATTTTGGAGAACAAAAGG - Intergenic
1059912510 9:119061159-119061181 TTTCAAATGTTGAAAATAAAGGG + Intergenic
1060086251 9:120705120-120705142 TCTCTCTTTTTGAAAAAAAATGG - Intronic
1185582823 X:1224208-1224230 TACCTATTGTGGAGAAAGAAAGG - Intergenic
1186912465 X:14183264-14183286 TTTCTTCTGTTGTCAAAAAAAGG + Intergenic
1186984097 X:14992617-14992639 TTTCTATTCTAGGGAAAAGAAGG + Intergenic
1187367640 X:18677645-18677667 TTCCTATTGCGGTGAAAAAATGG + Intronic
1187379591 X:18788142-18788164 TTTCTATTTTTTAGAAGAGACGG - Intronic
1187847511 X:23556108-23556130 TTTATTTTGTAGAGAAAAGAAGG - Intergenic
1188302917 X:28527684-28527706 TTTCTTTTTTTTAAAAAAAATGG - Intergenic
1188678712 X:32975487-32975509 ATTTTGTTGTTGAGAGAAAAAGG - Intronic
1189295964 X:39917983-39918005 GTTCTATTACTGAGAAGAAAGGG + Intergenic
1189604986 X:42667579-42667601 TTTCCATTATTTAGAAAAAATGG + Intergenic
1189667454 X:43372267-43372289 TTTCTATGTTTAAGAAAAAGTGG - Intergenic
1189695831 X:43660894-43660916 TCTCTTTAGTAGAGAAAAAAAGG + Intronic
1190135983 X:47798473-47798495 GTTCTTTTGTAGAGAAGAAAAGG + Intergenic
1190439600 X:50463811-50463833 TTGCTTGTTTTGAGAAAAAAAGG + Intronic
1191007405 X:55724329-55724351 TTTTTATGGATGAGGAAAAAGGG - Intronic
1191129243 X:56990674-56990696 ATTCTACTTTTGAGAAAAATTGG + Intronic
1191648441 X:63508939-63508961 TTTCAATAATTGAGAAAAATTGG - Intergenic
1191827816 X:65384592-65384614 TTGCTATAGTTTAAAAAAAATGG + Intronic
1192617640 X:72644574-72644596 TTTCTTTTAAAGAGAAAAAAAGG + Intronic
1193825199 X:86216740-86216762 TTTATATTGTTGAATAAAGAGGG + Intronic
1193968552 X:88020844-88020866 TTTGTATTGTTGCCAGAAAAGGG + Intergenic
1194000586 X:88424166-88424188 ACTCTATTGTTAAGAAAAAGAGG + Intergenic
1194039090 X:88917568-88917590 TTTCTGTTGGTCAGAAATAAGGG - Intergenic
1194311367 X:92311969-92311991 TTACTATTTTTGAGAGAATAGGG + Intronic
1194489147 X:94525590-94525612 TTTCTATTTCTGTGAAAAAATGG - Intergenic
1194844714 X:98790722-98790744 TTTCTAGTTTTGTGAAAAATTGG - Intergenic
1195692584 X:107639606-107639628 TTTCTATTGTTTTGAAGATAGGG - Intronic
1195778458 X:108434012-108434034 TTTCTATTAATGAGATAATAAGG + Intronic
1197369415 X:125608585-125608607 TTTCTAAAGATAAGAAAAAACGG + Intergenic
1197444866 X:126540473-126540495 TTACAATAGTTAAGAAAAAAGGG + Intergenic
1198622780 X:138532941-138532963 TTTCTATAGTTGTTAAATAAAGG + Intergenic
1198701617 X:139402831-139402853 CTGCTATTGTAGAAAAAAAATGG + Intergenic
1199064296 X:143396233-143396255 CTTTTAATGTTCAGAAAAAAAGG - Intergenic
1199184237 X:144896422-144896444 TTTCTATGGTATAGAAAAACTGG + Intergenic
1200619640 Y:5426190-5426212 TTACTATTTTTGAGAGAATAGGG + Intronic