ID: 971139581

View in Genome Browser
Species Human (GRCh38)
Location 4:23909593-23909615
Sequence AGTGACAGGCAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971139573_971139581 -4 Left 971139573 4:23909574-23909596 CCTGCTGGGACCCCAGGAAAGTG No data
Right 971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG No data
971139569_971139581 16 Left 971139569 4:23909554-23909576 CCTCTGGCTTTTGAGGGGTGCCT No data
Right 971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971139581 Original CRISPR AGTGACAGGCAGAAGGAGGA GGG Intergenic
No off target data available for this crispr