ID: 971139611

View in Genome Browser
Species Human (GRCh38)
Location 4:23909858-23909880
Sequence ATGATTCATCATTTGTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971139611_971139615 4 Left 971139611 4:23909858-23909880 CCTAGTGACAAATGATGAATCAT No data
Right 971139615 4:23909885-23909907 GGTCCAATGTTAGCTGCTAAGGG No data
971139611_971139614 3 Left 971139611 4:23909858-23909880 CCTAGTGACAAATGATGAATCAT No data
Right 971139614 4:23909884-23909906 AGGTCCAATGTTAGCTGCTAAGG No data
971139611_971139617 26 Left 971139611 4:23909858-23909880 CCTAGTGACAAATGATGAATCAT No data
Right 971139617 4:23909907-23909929 GAAATACAAAGAAATATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971139611 Original CRISPR ATGATTCATCATTTGTCACT AGG (reversed) Intergenic
No off target data available for this crispr