ID: 971139615

View in Genome Browser
Species Human (GRCh38)
Location 4:23909885-23909907
Sequence GGTCCAATGTTAGCTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971139611_971139615 4 Left 971139611 4:23909858-23909880 CCTAGTGACAAATGATGAATCAT No data
Right 971139615 4:23909885-23909907 GGTCCAATGTTAGCTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971139615 Original CRISPR GGTCCAATGTTAGCTGCTAA GGG Intergenic
No off target data available for this crispr