ID: 971141576

View in Genome Browser
Species Human (GRCh38)
Location 4:23930668-23930690
Sequence AAAAGTACATTGAACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971141576_971141577 10 Left 971141576 4:23930668-23930690 CCTTCAGGGTTCAATGTACTTTT No data
Right 971141577 4:23930701-23930723 TTTCCTACCCAGACTCTCAAAGG No data
971141576_971141582 26 Left 971141576 4:23930668-23930690 CCTTCAGGGTTCAATGTACTTTT No data
Right 971141582 4:23930717-23930739 TCAAAGGGACAAACACATGCAGG No data
971141576_971141578 11 Left 971141576 4:23930668-23930690 CCTTCAGGGTTCAATGTACTTTT No data
Right 971141578 4:23930702-23930724 TTCCTACCCAGACTCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971141576 Original CRISPR AAAAGTACATTGAACCCTGA AGG (reversed) Intergenic
No off target data available for this crispr